Incidental Mutation 'R3605:Fgfrl1'
ID269047
Institutional Source Beutler Lab
Gene Symbol Fgfrl1
Ensembl Gene ENSMUSG00000008090
Gene Namefibroblast growth factor receptor-like 1
SynonymsFGFR5, FGFR5beta, FGFR5gamma, fibroblast growth factor receptor 5
MMRRC Submission 040670-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3605 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108692382-108706924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108705423 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 213 (T213K)
Ref Sequence ENSEMBL: ENSMUSP00000108179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013633] [ENSMUST00000112560] [ENSMUST00000196222] [ENSMUST00000197255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013633
AA Change: T304K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000013633
Gene: ENSMUSG00000008090
AA Change: T304K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 2.64e-12 SMART
low complexity region 117 131 N/A INTRINSIC
IGc2 159 224 1.35e-18 SMART
IGc2 255 341 6.16e-4 SMART
transmembrane domain 372 394 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112560
AA Change: T213K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108179
Gene: ENSMUSG00000008090
AA Change: T213K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 40 N/A INTRINSIC
IGc2 68 133 1.35e-18 SMART
IGc2 164 250 6.16e-4 SMART
transmembrane domain 281 303 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196222
SMART Domains Protein: ENSMUSP00000143037
Gene: ENSMUSG00000008090

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 1.1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199802
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death due to respiratory distress, a malformed diaphragm, and lack of metanephric kidneys. Homozygotes for a different null allele show both fetal and neonatal death, a similar diaphragm defect, as well as cardiac and skeletal defects, and fetal anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd35 C T 3: 96,682,181 Q239* probably null Het
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Art2b T A 7: 101,579,945 N249I probably benign Het
Bpifb1 T A 2: 154,211,565 N242K possibly damaging Het
Cd200r1 A G 16: 44,789,576 T53A possibly damaging Het
Cracr2b C T 7: 141,466,146 P370S possibly damaging Het
Crb1 T A 1: 139,237,339 T1016S probably damaging Het
Esrrg A G 1: 188,211,102 H424R possibly damaging Het
Flrt3 T A 2: 140,661,367 N114Y probably damaging Het
Fsip2 T C 2: 82,984,909 V3662A probably benign Het
Gabra6 T A 11: 42,314,950 I359F probably benign Het
Gal A G 19: 3,414,026 probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm5814 G T 17: 47,410,505 R48L probably damaging Het
Hcn1 G A 13: 117,975,252 G584D unknown Het
Iqgap1 T C 7: 80,723,789 D1484G probably benign Het
Kmt2a G A 9: 44,849,196 T485M probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Lctl T C 9: 64,133,193 Y473H probably damaging Het
Lrrc8d G A 5: 105,827,007 C93Y unknown Het
Mnt T A 11: 74,836,920 S211T possibly damaging Het
Mtdh T A 15: 34,114,112 probably benign Het
Nxt1 T C 2: 148,675,479 W47R probably damaging Het
Olfr1312 T A 2: 112,042,823 I70F probably benign Het
Olfr195 T C 16: 59,149,483 I211T probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rbl1 A T 2: 157,177,233 F531I probably damaging Het
Rpap2 A G 5: 107,620,529 D411G probably damaging Het
Sapcd1 A G 17: 35,027,805 F36L probably damaging Het
Svep1 A T 4: 58,066,542 S3181T probably benign Het
Tgfbr2 G A 9: 116,109,892 T314I probably benign Het
Thbs4 G T 13: 92,757,959 C685* probably null Het
Tk2 A G 8: 104,231,171 V181A possibly damaging Het
Traf2 T C 2: 25,530,415 T141A probably benign Het
Ttn C T 2: 76,831,444 probably null Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Yif1b C T 7: 29,238,410 A7V possibly damaging Het
Zfp738 A T 13: 67,671,389 L151* probably null Het
Other mutations in Fgfrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Fgfrl1 APN 5 108705887 missense probably damaging 1.00
IGL00756:Fgfrl1 APN 5 108705953 missense possibly damaging 0.91
IGL02641:Fgfrl1 APN 5 108705865 missense probably damaging 1.00
R0725:Fgfrl1 UTSW 5 108704673 missense probably damaging 0.99
R1398:Fgfrl1 UTSW 5 108706281 unclassified probably benign
R1967:Fgfrl1 UTSW 5 108705005 missense probably damaging 1.00
R2403:Fgfrl1 UTSW 5 108705031 missense probably damaging 1.00
R3032:Fgfrl1 UTSW 5 108706060 missense probably benign 0.13
R3606:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3607:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3767:Fgfrl1 UTSW 5 108705376 missense possibly damaging 0.78
R4603:Fgfrl1 UTSW 5 108703535 missense probably damaging 1.00
R4798:Fgfrl1 UTSW 5 108703497 nonsense probably null
R5600:Fgfrl1 UTSW 5 108705302 missense probably damaging 1.00
R6349:Fgfrl1 UTSW 5 108705506 missense probably damaging 1.00
R6679:Fgfrl1 UTSW 5 108704972 nonsense probably null
R6679:Fgfrl1 UTSW 5 108704973 missense probably damaging 1.00
R7247:Fgfrl1 UTSW 5 108703499 missense possibly damaging 0.91
X0018:Fgfrl1 UTSW 5 108704974 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCCTTGGCTTAGAGCGGAC -3'
(R):5'- CCCAGACCAATGGTAGAGACTG -3'

Sequencing Primer
(F):5'- TGTGCTCACAGGGACACAC -3'
(R):5'- CCAATGGTAGAGACTGAGAGTAAAC -3'
Posted On2015-02-19