Mutagenetix > Incidental Mutation

Incidental Mutation 'R3606:Fgfrl1'

269083

Institutional Source

Beutler Lab

Gene Symbol

Fgfrl1

Ensembl Gene

ENSMUSG00000008090

Gene Name

fibroblast growth factor receptor-like 1

Synonyms

FGFR5gamma, fibroblast growth factor receptor 5, FGFR5, FGFR5beta

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3606 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108842051-108854816 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 108853289 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 213 (T213K)

Ref Sequence

ENSEMBL: ENSMUSP00000108179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013633] [ENSMUST00000112560] [ENSMUST00000196222] [ENSMUST00000197255]

AlphaFold

Q91V87

Predicted Effect

possibly damaging
Transcript: ENSMUST00000013633
AA Change: T304K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000013633
Gene: ENSMUSG00000008090
AA Change: T304K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	38	102	2.64e-12	SMART
low complexity region	117	131	N/A	INTRINSIC
IGc2	159	224	1.35e-18	SMART
IGc2	255	341	6.16e-4	SMART
transmembrane domain	372	394	N/A	INTRINSIC
low complexity region	468	479	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112560
AA Change: T213K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108179
Gene: ENSMUSG00000008090
AA Change: T213K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	26	40	N/A	INTRINSIC
IGc2	68	133	1.35e-18	SMART
IGc2	164	250	6.16e-4	SMART
transmembrane domain	281	303	N/A	INTRINSIC
low complexity region	377	388	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196222

SMART Domains

Protein: ENSMUSP00000143037
Gene: ENSMUSG00000008090

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	38	102	1.1e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000197255

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199802

Meta Mutation Damage Score

0.3067

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 97.0%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death due to respiratory distress, a malformed diaphragm, and lack of metanephric kidneys. Homozygotes for a different null allele show both fetal and neonatal death, a similar diaphragm defect, as well as cardiac and skeletal defects, and fetal anemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arid4b	T	C	13: 14,294,826 (GRCm39)	V36A	probably damaging	Het
Cd101	A	T	3: 100,927,913 (GRCm39)	I56N	probably damaging	Het
Cs	A	T	10: 128,195,892 (GRCm39)	H367L	probably benign	Het
Ddb1	A	G	19: 10,605,857 (GRCm39)	E1095G	probably damaging	Het
Ift70a1	T	C	2: 75,811,621 (GRCm39)	D154G	probably benign	Het
Kprp	C	A	3: 92,731,588 (GRCm39)	Q487H	unknown	Het
Myom2	T	C	8: 15,119,775 (GRCm39)	V177A	probably damaging	Het
Nelfcd	A	G	2: 174,268,337 (GRCm39)	Y525C	probably benign	Het
Or2t49	C	T	11: 58,392,957 (GRCm39)	V148M	possibly damaging	Het
Or5i1	C	A	2: 87,613,551 (GRCm39)	F222L	probably benign	Het
Pcdhgc5	A	G	18: 37,953,560 (GRCm39)	D278G	probably benign	Het
Peg3	T	C	7: 6,711,508 (GRCm39)	E1238G	probably damaging	Het
Plekha7	T	C	7: 115,763,477 (GRCm39)	D313G	possibly damaging	Het
Ppp1r9a	A	G	6: 5,113,674 (GRCm39)	N726S	possibly damaging	Het
Psmd3	C	T	11: 98,581,780 (GRCm39)	R302W	probably damaging	Het
Ptbp2	A	G	3: 119,541,281 (GRCm39)	L223P	probably damaging	Het
Ranbp10	A	G	8: 106,502,667 (GRCm39)	S300P	probably benign	Het
Rundc3b	A	T	5: 8,562,386 (GRCm39)	D327E	probably damaging	Het
Tsr1	T	C	11: 74,796,059 (GRCm39)	S562P	probably benign	Het
Ube3c	A	G	5: 29,803,936 (GRCm39)	T180A	possibly damaging	Het

Other mutations in Fgfrl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00489:Fgfrl1	APN	5	108,853,753 (GRCm39)	missense	probably damaging	1.00
IGL00756:Fgfrl1	APN	5	108,853,819 (GRCm39)	missense	possibly damaging	0.91
IGL02641:Fgfrl1	APN	5	108,853,731 (GRCm39)	missense	probably damaging	1.00
R0725:Fgfrl1	UTSW	5	108,852,539 (GRCm39)	missense	probably damaging	0.99
R1398:Fgfrl1	UTSW	5	108,854,147 (GRCm39)	unclassified	probably benign
R1967:Fgfrl1	UTSW	5	108,852,871 (GRCm39)	missense	probably damaging	1.00
R2403:Fgfrl1	UTSW	5	108,852,897 (GRCm39)	missense	probably damaging	1.00
R3032:Fgfrl1	UTSW	5	108,853,926 (GRCm39)	missense	probably benign	0.13
R3605:Fgfrl1	UTSW	5	108,853,289 (GRCm39)	missense	probably damaging	0.96
R3607:Fgfrl1	UTSW	5	108,853,289 (GRCm39)	missense	probably damaging	0.96
R3767:Fgfrl1	UTSW	5	108,853,242 (GRCm39)	missense	possibly damaging	0.78
R4603:Fgfrl1	UTSW	5	108,851,401 (GRCm39)	missense	probably damaging	1.00
R4798:Fgfrl1	UTSW	5	108,851,363 (GRCm39)	nonsense	probably null
R5600:Fgfrl1	UTSW	5	108,853,168 (GRCm39)	missense	probably damaging	1.00
R6349:Fgfrl1	UTSW	5	108,853,372 (GRCm39)	missense	probably damaging	1.00
R6679:Fgfrl1	UTSW	5	108,852,839 (GRCm39)	missense	probably damaging	1.00
R6679:Fgfrl1	UTSW	5	108,852,838 (GRCm39)	nonsense	probably null
R7247:Fgfrl1	UTSW	5	108,851,365 (GRCm39)	missense	possibly damaging	0.91
R7608:Fgfrl1	UTSW	5	108,853,211 (GRCm39)	missense	probably damaging	1.00
R7947:Fgfrl1	UTSW	5	108,853,142 (GRCm39)	missense	probably damaging	0.96
R8933:Fgfrl1	UTSW	5	108,851,257 (GRCm39)	missense	probably damaging	0.96
R9039:Fgfrl1	UTSW	5	108,853,439 (GRCm39)	critical splice donor site	probably null
R9661:Fgfrl1	UTSW	5	108,853,841 (GRCm39)	missense	probably benign
X0018:Fgfrl1	UTSW	5	108,852,840 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTCCTTGGCTTAGAGCGGAC -3'
(R):5'- CCAGACCAATGGTAGAGACTG -3'

Sequencing Primer
(F):5'- TGTGCTCACAGGGACACAC -3'
(R):5'- CCAATGGTAGAGACTGAGAGTAAAC -3'

Posted On

2015-02-19