Incidental Mutation 'R3606:Fgfrl1'
ID269083
Institutional Source Beutler Lab
Gene Symbol Fgfrl1
Ensembl Gene ENSMUSG00000008090
Gene Namefibroblast growth factor receptor-like 1
SynonymsFGFR5, FGFR5beta, FGFR5gamma, fibroblast growth factor receptor 5
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3606 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108692382-108706924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 108705423 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 213 (T213K)
Ref Sequence ENSEMBL: ENSMUSP00000108179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013633] [ENSMUST00000112560] [ENSMUST00000196222] [ENSMUST00000197255]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013633
AA Change: T304K

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000013633
Gene: ENSMUSG00000008090
AA Change: T304K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 2.64e-12 SMART
low complexity region 117 131 N/A INTRINSIC
IGc2 159 224 1.35e-18 SMART
IGc2 255 341 6.16e-4 SMART
transmembrane domain 372 394 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112560
AA Change: T213K

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108179
Gene: ENSMUSG00000008090
AA Change: T213K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 40 N/A INTRINSIC
IGc2 68 133 1.35e-18 SMART
IGc2 164 250 6.16e-4 SMART
transmembrane domain 281 303 N/A INTRINSIC
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196222
SMART Domains Protein: ENSMUSP00000143037
Gene: ENSMUSG00000008090

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 38 102 1.1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199802
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A marked difference between this gene product and the other family members is its lack of a cytoplasmic tyrosine kinase domain. The result is a transmembrane receptor that could interact with other family members and potentially inhibit signaling. Multiple alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death due to respiratory distress, a malformed diaphragm, and lack of metanephric kidneys. Homozygotes for a different null allele show both fetal and neonatal death, a similar diaphragm defect, as well as cardiac and skeletal defects, and fetal anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid4b T C 13: 14,120,241 V36A probably damaging Het
Cd101 A T 3: 101,020,597 I56N probably damaging Het
Cs A T 10: 128,360,023 H367L probably benign Het
Ddb1 A G 19: 10,628,493 E1095G probably damaging Het
Kprp C A 3: 92,824,281 Q487H unknown Het
Myom2 T C 8: 15,069,775 V177A probably damaging Het
Nelfcd A G 2: 174,426,544 Y525C probably benign Het
Olfr152 C A 2: 87,783,207 F222L probably benign Het
Olfr331 C T 11: 58,502,131 V148M possibly damaging Het
Pcdhgc5 A G 18: 37,820,507 D278G probably benign Het
Peg3 T C 7: 6,708,509 E1238G probably damaging Het
Plekha7 T C 7: 116,164,242 D313G possibly damaging Het
Ppp1r9a A G 6: 5,113,674 N726S possibly damaging Het
Psmd3 C T 11: 98,690,954 R302W probably damaging Het
Ptbp2 A G 3: 119,747,632 L223P probably damaging Het
Ranbp10 A G 8: 105,776,035 S300P probably benign Het
Rundc3b A T 5: 8,512,386 D327E probably damaging Het
Tsr1 T C 11: 74,905,233 S562P probably benign Het
Ttc30a1 T C 2: 75,981,277 D154G probably benign Het
Ube3c A G 5: 29,598,938 T180A possibly damaging Het
Other mutations in Fgfrl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Fgfrl1 APN 5 108705887 missense probably damaging 1.00
IGL00756:Fgfrl1 APN 5 108705953 missense possibly damaging 0.91
IGL02641:Fgfrl1 APN 5 108705865 missense probably damaging 1.00
R0725:Fgfrl1 UTSW 5 108704673 missense probably damaging 0.99
R1398:Fgfrl1 UTSW 5 108706281 unclassified probably benign
R1967:Fgfrl1 UTSW 5 108705005 missense probably damaging 1.00
R2403:Fgfrl1 UTSW 5 108705031 missense probably damaging 1.00
R3032:Fgfrl1 UTSW 5 108706060 missense probably benign 0.13
R3605:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3607:Fgfrl1 UTSW 5 108705423 missense probably damaging 0.96
R3767:Fgfrl1 UTSW 5 108705376 missense possibly damaging 0.78
R4603:Fgfrl1 UTSW 5 108703535 missense probably damaging 1.00
R4798:Fgfrl1 UTSW 5 108703497 nonsense probably null
R5600:Fgfrl1 UTSW 5 108705302 missense probably damaging 1.00
R6349:Fgfrl1 UTSW 5 108705506 missense probably damaging 1.00
R6679:Fgfrl1 UTSW 5 108704972 nonsense probably null
R6679:Fgfrl1 UTSW 5 108704973 missense probably damaging 1.00
R7247:Fgfrl1 UTSW 5 108703499 missense possibly damaging 0.91
X0018:Fgfrl1 UTSW 5 108704974 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCTTGGCTTAGAGCGGAC -3'
(R):5'- CCAGACCAATGGTAGAGACTG -3'

Sequencing Primer
(F):5'- TGTGCTCACAGGGACACAC -3'
(R):5'- CCAATGGTAGAGACTGAGAGTAAAC -3'
Posted On2015-02-19