Incidental Mutation 'R3706:Rab11b'
ID271789
Institutional Source Beutler Lab
Gene Symbol Rab11b
Ensembl Gene ENSMUSG00000077450
Gene NameRAB11B, member RAS oncogene family
SynonymsA730055L17Rik
MMRRC Submission 040699-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R3706 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33742484-33760530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 33747766 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 162 (H162D)
Ref Sequence ENSEMBL: ENSMUSP00000134448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057373] [ENSMUST00000173860] [ENSMUST00000173987]
Predicted Effect probably benign
Transcript: ENSMUST00000057373
AA Change: H187D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110021
Gene: ENSMUSG00000077450
AA Change: H187D

DomainStartEndE-ValueType
RAB 12 175 3.76e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172894
SMART Domains Protein: ENSMUSP00000134544
Gene: ENSMUSG00000077450

DomainStartEndE-ValueType
RAB 2 118 3.53e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173860
AA Change: H162D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134448
Gene: ENSMUSG00000077450
AA Change: H162D

DomainStartEndE-ValueType
RAB 12 150 3.17e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173987
SMART Domains Protein: ENSMUSP00000133921
Gene: ENSMUSG00000077450

DomainStartEndE-ValueType
RAB 12 149 2.81e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174744
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Ras superfamily of small GTP-binding proteins, which includes the Ras (see MIM 190020), Ral (see MIM 179550), Rho (see MIM 165390), Rap (see MIM 179520), and Rab (see MIM 179508) families, is involved in controlling a diverse set of essential cellular functions. The Rab family, including RAB11B, appears to play a critical role in regulating exocytotic and endocytotic pathways (summary by Zhu et al., 1994 [PubMed 7811277]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
Ahnak2 G A 12: 112,773,651 P523L possibly damaging Het
Ampd1 A G 3: 103,088,311 probably benign Het
Anxa10 T A 8: 62,064,287 K167M probably damaging Het
Atp8b2 A T 3: 89,945,152 F866I probably damaging Het
Atxn2 T C 5: 121,785,868 probably null Het
Card11 G A 5: 140,887,135 R608C probably damaging Het
Cd4 T C 6: 124,879,388 K47E probably benign Het
Cenpl G A 1: 161,078,415 V120M probably damaging Het
Cfap69 G T 5: 5,613,843 Y461* probably null Het
Crct1 C A 3: 93,014,707 probably benign Het
Ddx24 A T 12: 103,417,416 V592E probably damaging Het
Dmc1 G C 15: 79,562,581 P264A probably damaging Het
Donson A G 16: 91,686,161 probably benign Het
Elovl5 C A 9: 77,979,837 A170E probably null Het
Emilin1 A G 5: 30,917,822 E469G possibly damaging Het
Fam178b A G 1: 36,608,448 Y235H probably damaging Het
Fgfr2 T C 7: 130,198,431 T358A probably benign Het
Fpgs A T 2: 32,687,996 I138N probably damaging Het
Glb1l2 A G 9: 26,771,020 probably benign Het
Hspa4l A T 3: 40,781,693 N582I possibly damaging Het
Immt T C 6: 71,862,362 M226T probably benign Het
Kif21b A G 1: 136,159,410 N875S probably benign Het
Lama2 T C 10: 27,138,996 D1572G probably damaging Het
Lelp1 A C 3: 92,135,407 C112G unknown Het
Mctp2 A G 7: 72,214,111 probably benign Het
Mettl2 T A 11: 105,139,726 I376N probably benign Het
Mycbp2 A T 14: 103,156,414 S2904T probably benign Het
Nwd1 A G 8: 72,667,116 T377A possibly damaging Het
Olfr1445 C T 19: 12,883,896 T5I probably damaging Het
Olfr1494 T A 19: 13,749,112 L2Q probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Phip T C 9: 82,900,743 E883G probably benign Het
Phox2b T C 5: 67,096,529 probably benign Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Reln T C 5: 21,995,589 probably benign Het
Sgo2b T C 8: 63,928,145 E551G probably damaging Het
Sucla2 A G 14: 73,591,052 K336R probably damaging Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Zim1 T C 7: 6,677,291 I458V probably damaging Het
Other mutations in Rab11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Rab11b APN 17 33749816 missense probably damaging 1.00
R1969:Rab11b UTSW 17 33760235 missense probably damaging 1.00
R2096:Rab11b UTSW 17 33749002 missense probably damaging 1.00
R2566:Rab11b UTSW 17 33747718 missense probably benign 0.01
R4093:Rab11b UTSW 17 33749789 missense possibly damaging 0.94
R5070:Rab11b UTSW 17 33748881 missense probably damaging 1.00
R5218:Rab11b UTSW 17 33748950 missense probably benign 0.03
R5306:Rab11b UTSW 17 33760269 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- ACGCTGGGTCAAAGTGCAG -3'
(R):5'- CCCTACAGTGTGGTGGAGAATTG -3'

Sequencing Primer
(F):5'- ATTTCTGAGTTCGAGGCCAGCC -3'
(R):5'- TACTAGAAGCAGCTGGTCATGCC -3'
Posted On2015-03-25