Incidental Mutation 'R3773:Stxbp5'
ID273442
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Namesyntaxin binding protein 5 (tomosyn)
Synonyms4930565N16Rik, 0710001E20Rik, LGL3, tomosyn 1
MMRRC Submission 040749-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3773 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location9755547-9901079 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9768927 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 960 (T960I)
Ref Sequence ENSEMBL: ENSMUSP00000123253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000136324] [ENSMUST00000141722]
Predicted Effect probably damaging
Transcript: ENSMUST00000038213
AA Change: T996I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: T996I

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000125200
AA Change: T943I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: T943I

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128487
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136259
Predicted Effect probably benign
Transcript: ENSMUST00000136324
SMART Domains Protein: ENSMUSP00000123355
Gene: ENSMUSG00000019790

DomainStartEndE-ValueType
low complexity region 98 106 N/A INTRINSIC
low complexity region 209 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139199
Predicted Effect probably damaging
Transcript: ENSMUST00000141722
AA Change: T960I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: T960I

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151435
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T C 17: 56,876,262 M1T probably null Het
1810041L15Rik A T 15: 84,406,685 Y120* probably null Het
A2ml1 T A 6: 128,555,083 K899N probably benign Het
Adgrv1 G A 13: 81,499,043 S3126L probably damaging Het
Apba3 C A 10: 81,272,609 probably null Het
Apobec4 G T 1: 152,756,805 A195S probably benign Het
Asap3 C T 4: 136,227,575 T72I probably benign Het
BC067074 A G 13: 113,318,209 E263G probably benign Het
Cand2 T A 6: 115,785,217 H201Q probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Chd1 A G 17: 17,374,651 D16G probably damaging Het
Csgalnact2 T C 6: 118,126,219 K19E probably benign Het
Cyp17a1 T G 19: 46,669,723 K250T probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dgcr8 T C 16: 18,256,775 D712G probably damaging Het
Dsg2 T C 18: 20,591,862 W442R probably damaging Het
Elavl2 C T 4: 91,264,088 G131R probably damaging Het
Elf1 T C 14: 79,567,210 V105A possibly damaging Het
Ercc6l2 A G 13: 63,841,450 D270G probably damaging Het
Fmn1 T G 2: 113,582,118 S996A probably damaging Het
Frmd4a A T 2: 4,590,622 E109D probably damaging Het
Fry A T 5: 150,398,198 R999S probably damaging Het
Gak G A 5: 108,582,672 T956I probably benign Het
Gm6614 T C 6: 141,972,335 K605R probably benign Het
Gm9008 C T 6: 76,496,959 V225I probably benign Het
Gps2 T C 11: 69,916,101 F21L probably damaging Het
Grhl3 C T 4: 135,555,847 W303* probably null Het
Hmcn2 C T 2: 31,360,896 T790M probably damaging Het
Lrp5 G A 19: 3,612,330 R173C probably damaging Het
Matk T A 10: 81,258,297 L21Q probably benign Het
Mthfr T C 4: 148,044,450 V160A probably benign Het
Nhlrc4 T A 17: 25,943,393 K127* probably null Het
Nsd1 G A 13: 55,246,673 V696I probably benign Het
Nup210l T G 3: 90,119,894 Y194* probably null Het
Olfr1497 T A 19: 13,795,204 M136L probably benign Het
Olfr345 A T 2: 36,640,321 Y94F probably benign Het
Olfr57 G A 10: 79,035,180 C128Y possibly damaging Het
Olfr90 G T 17: 37,086,065 Y33* probably null Het
Pcdhb15 T A 18: 37,475,890 V725D probably benign Het
Pes1 A G 11: 3,975,548 Y221C probably damaging Het
Prkd3 T C 17: 78,959,106 I603V possibly damaging Het
Ptpn13 A G 5: 103,477,121 E97G probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Ptprs T C 17: 56,428,978 T152A possibly damaging Het
Rims1 T C 1: 22,421,810 D842G probably damaging Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Rngtt T C 4: 33,330,889 I164T probably damaging Het
Scn9a T C 2: 66,483,648 N1909D probably benign Het
Ska3 C T 14: 57,810,077 V334I probably benign Het
Srebf2 A G 15: 82,182,108 K579R probably benign Het
Suco A T 1: 161,843,996 probably null Het
Tecta T C 9: 42,330,996 T2094A probably damaging Het
Tenm4 A T 7: 96,694,880 R227W probably damaging Het
Tmem131l A G 3: 83,898,586 S1517P probably damaging Het
Trio A G 15: 27,748,091 S2492P probably damaging Het
Tsg101 T C 7: 46,889,615 *254W probably null Het
Ttn T C 2: 76,771,367 T16872A probably benign Het
Ugt2b38 A G 5: 87,424,095 V26A probably damaging Het
Upb1 T A 10: 75,439,838 probably null Het
Vmn1r32 T A 6: 66,553,367 I142F probably benign Het
Vmn1r60 C A 7: 5,544,711 C130F possibly damaging Het
Vmn2r101 A G 17: 19,589,657 D235G probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn2 T C 2: 147,061,287 V765A probably benign Het
Zbed4 T C 15: 88,780,847 S373P probably benign Het
Zfp251 A G 15: 76,853,636 I414T possibly damaging Het
Zfp423 A T 8: 87,780,512 L1047Q probably benign Het
Zfp426 A T 9: 20,473,117 probably null Het
Zfp61 T C 7: 24,295,981 M1V probably null Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9799950 missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9808602 splice site probably benign
IGL01725:Stxbp5 APN 10 9817411 missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9762821 missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9816297 missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9762956 nonsense probably null
IGL02720:Stxbp5 APN 10 9789361 critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9816290 missense probably null 1.00
IGL03288:Stxbp5 APN 10 9866703 splice site probably null
Fatty_fish UTSW 10 9770551 missense probably damaging 1.00
reindeer UTSW 10 9838092 missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9769443 missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9817304 critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9762748 missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9770528 missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9866698 splice site probably benign
R0631:Stxbp5 UTSW 10 9784358 missense probably benign
R0723:Stxbp5 UTSW 10 9768873 missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9865099 missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9809040 missense possibly damaging 0.86
R1225:Stxbp5 UTSW 10 9812391 missense possibly damaging 0.94
R1271:Stxbp5 UTSW 10 9816269 missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9838092 missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9812298 missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9835846 missense possibly damaging 0.69
R3901:Stxbp5 UTSW 10 9769419 missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9789316 intron probably benign
R4572:Stxbp5 UTSW 10 9838144 missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9770623 missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9762891 missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9812341 nonsense probably null
R4887:Stxbp5 UTSW 10 9809100 missense probably benign
R4930:Stxbp5 UTSW 10 9760866 utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9770551 missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9798275 critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9799991 missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9808508 missense probably benign
R5531:Stxbp5 UTSW 10 9762924 nonsense probably null
R5605:Stxbp5 UTSW 10 9769746 intron probably benign
R5614:Stxbp5 UTSW 10 9760894 utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9900586 missense probably benign
R5990:Stxbp5 UTSW 10 9835933 missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9800028 missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9770686 missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9808472 missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9817339 missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9767179 missense probably benign 0.32
R6284:Stxbp5 UTSW 10 9767187 missense probably damaging 1.00
R6394:Stxbp5 UTSW 10 9899231 nonsense probably null
R6427:Stxbp5 UTSW 10 9899254 missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9784361 missense probably benign 0.00
X0020:Stxbp5 UTSW 10 9762890 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TGTGATAAAACAGACACGATTCCG -3'
(R):5'- GCATTCAGAGTAGTGGCTTCTG -3'

Sequencing Primer
(F):5'- GACACGATTCCGAGTCCC -3'
(R):5'- TCTGAGTGTGCTGTCTTCATATATAG -3'
Posted On2015-03-25