Incidental Mutation 'R3969:Lins1'
ID310875
Institutional Source Beutler Lab
Gene Symbol Lins1
Ensembl Gene ENSMUSG00000053091
Gene Namelines homolog 1
SynonymsWins2, Lins, 2700083B01Rik
MMRRC Submission 040937-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R3969 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location66689889-66717256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 66708198 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 27 (T27I)
Ref Sequence ENSEMBL: ENSMUSP00000112404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065323] [ENSMUST00000077967] [ENSMUST00000121777] [ENSMUST00000130161] [ENSMUST00000133771] [ENSMUST00000150071] [ENSMUST00000153007] [ENSMUST00000153773]
Predicted Effect probably benign
Transcript: ENSMUST00000065323
AA Change: T27I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000077967
AA Change: T27I

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000077117
Gene: ENSMUSG00000053091
AA Change: T27I

DomainStartEndE-ValueType
Pfam:LINES_N 204 554 1.6e-119 PFAM
low complexity region 641 652 N/A INTRINSIC
low complexity region 684 699 N/A INTRINSIC
Pfam:LINES_C 717 755 5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121777
AA Change: T27I

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112404
Gene: ENSMUSG00000053091
AA Change: T27I

DomainStartEndE-ValueType
Pfam:LINES_N 210 558 9.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
Pfam:LINES_C 723 759 2.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128486
Predicted Effect probably benign
Transcript: ENSMUST00000130161
AA Change: T27I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132181
Predicted Effect unknown
Transcript: ENSMUST00000132351
AA Change: T7I
SMART Domains Protein: ENSMUSP00000115180
Gene: ENSMUSG00000053091
AA Change: T7I

DomainStartEndE-ValueType
Pfam:LINES_N 155 244 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133199
SMART Domains Protein: ENSMUSP00000115124
Gene: ENSMUSG00000053091

DomainStartEndE-ValueType
Pfam:LINES_N 1 220 3.4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133771
AA Change: T27I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000150071
AA Change: T27I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000153007
AA Change: T27I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000153773
SMART Domains Protein: ENSMUSP00000119187
Gene: ENSMUSG00000053091

DomainStartEndE-ValueType
Pfam:LINES_N 75 229 1.3e-40 PFAM
Meta Mutation Damage Score 0.1064 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Drosophila segment polarity gene lin encodes a protein, lines, which plays important roles in development of the epidermis and hindgut. This gene encodes a protein containing a lines-like domain. This gene is located on chromosome 15 and clustered with the gene encoding ankyrin repeat and SOCS box-containing protein 7. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahi1 A G 10: 20,959,947 K60E probably damaging Het
Arhgef12 C A 9: 43,005,551 R432L probably damaging Het
Armcx6 G T X: 134,749,756 H109N possibly damaging Het
Camk2d G T 3: 126,796,959 C273F possibly damaging Het
Camk4 T A 18: 33,179,581 I258N possibly damaging Het
Chia1 T G 3: 106,121,635 probably null Het
Commd9 C A 2: 101,897,141 N93K probably benign Het
Cpeb4 T C 11: 31,872,811 I175T possibly damaging Het
Dnah17 G A 11: 118,041,158 probably benign Het
E2f1 C G 2: 154,564,022 G144R probably damaging Het
Faap100 A T 11: 120,378,705 M1K probably null Het
Fam196b A T 11: 34,419,739 Q481L probably damaging Het
Flna A T X: 74,235,667 V1253E probably damaging Het
Fryl A T 5: 73,112,423 S396R probably damaging Het
Gm12185 A T 11: 48,907,345 C774S probably benign Het
Habp2 A G 19: 56,311,701 Y194C probably damaging Het
Irf5 A T 6: 29,536,782 Q497H probably benign Het
Lama3 A T 18: 12,580,341 K3230M probably damaging Het
Ncstn A C 1: 172,070,009 V439G probably damaging Het
Nlrx1 A T 9: 44,255,425 probably benign Het
Nol8 A T 13: 49,660,016 K162* probably null Het
Olfr836 A G 9: 19,121,660 E232G probably benign Het
Olfr921 A G 9: 38,775,368 T38A probably benign Het
Pabpc5 A G X: 119,928,624 E212G probably benign Het
Pecr G A 1: 72,276,309 T94I probably damaging Het
Piezo2 A T 18: 63,011,696 V2776E probably damaging Het
Pik3r2 G A 8: 70,770,421 R452C probably benign Het
Pole3 G T 4: 62,524,961 N12K possibly damaging Het
Prl2a1 A G 13: 27,806,280 S71G probably benign Het
Rab39 G A 9: 53,686,632 A111V possibly damaging Het
Rb1cc1 T A 1: 6,248,270 probably benign Het
Shroom3 T C 5: 92,940,879 V496A probably benign Het
Slc26a1 A G 5: 108,673,952 S24P probably benign Het
Tspoap1 A T 11: 87,762,446 N113Y probably damaging Het
Usp17lc A T 7: 103,418,419 H307L probably damaging Het
Vmn2r79 T C 7: 87,003,593 W498R probably damaging Het
Vmn2r94 C A 17: 18,258,385 Q33H possibly damaging Het
Wwc2 T C 8: 47,856,323 D808G unknown Het
Ybx2 G A 11: 69,940,416 R84Q probably damaging Het
Zfp462 C T 4: 55,012,402 S308F probably damaging Het
Other mutations in Lins1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Lins1 APN 7 66714531 nonsense probably null
IGL01402:Lins1 APN 7 66713928 missense probably damaging 0.99
IGL01404:Lins1 APN 7 66713928 missense probably damaging 0.99
IGL01887:Lins1 APN 7 66710381 missense probably damaging 0.98
IGL02887:Lins1 APN 7 66714183 missense probably damaging 0.99
R0089:Lins1 UTSW 7 66712048 unclassified probably benign
R1473:Lins1 UTSW 7 66712046 critical splice donor site probably null
R1556:Lins1 UTSW 7 66710637 nonsense probably null
R1580:Lins1 UTSW 7 66714491 missense probably benign 0.10
R1794:Lins1 UTSW 7 66711909 missense probably damaging 1.00
R1848:Lins1 UTSW 7 66714322 missense probably damaging 0.98
R4760:Lins1 UTSW 7 66714687 unclassified probably benign
R4766:Lins1 UTSW 7 66710641 missense possibly damaging 0.92
R4811:Lins1 UTSW 7 66708150 missense probably benign 0.00
R4941:Lins1 UTSW 7 66709450 splice site probably benign
R5419:Lins1 UTSW 7 66708095 unclassified probably benign
R6140:Lins1 UTSW 7 66711924 missense probably damaging 1.00
R6258:Lins1 UTSW 7 66710748 critical splice donor site probably null
R6713:Lins1 UTSW 7 66708482 missense probably benign 0.00
R6787:Lins1 UTSW 7 66714154 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CGAAGTGAACACAGTCTTGTTTC -3'
(R):5'- GAAGCTGTCTCTTGGGACACTC -3'

Sequencing Primer
(F):5'- GTGAACACAGTCTTGTTTCACTTG -3'
(R):5'- CACTGGCATTAGACTGAG -3'
Posted On2015-04-29