Incidental Mutation 'R4096:Olfr1023'
ID317121
Institutional Source Beutler Lab
Gene Symbol Olfr1023
Ensembl Gene ENSMUSG00000050128
Gene Nameolfactory receptor 1023
SynonymsMOR196-3, GA_x6K02T2Q125-47363965-47364900
MMRRC Submission 041629-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R4096 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85885640-85891213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85887423 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 208 (S208P)
Ref Sequence ENSEMBL: ENSMUSP00000149138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056408] [ENSMUST00000213441]
Predicted Effect probably damaging
Transcript: ENSMUST00000056408
AA Change: S208P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000059849
Gene: ENSMUSG00000050128
AA Change: S208P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.6e-7 PFAM
Pfam:7tm_1 41 290 2.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082871
Predicted Effect probably damaging
Transcript: ENSMUST00000213441
AA Change: S208P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,972,149 D255G possibly damaging Het
4930407I10Rik G A 15: 82,062,205 G101D probably benign Het
Angpt2 G A 8: 18,698,095 A383V probably damaging Het
Ctns A G 11: 73,186,386 M252T probably benign Het
Dmxl1 T A 18: 49,961,197 H2913Q probably damaging Het
Enox1 C T 14: 77,577,720 T106M probably damaging Het
Ext1 A T 15: 53,073,357 V664E probably damaging Het
Fat4 A T 3: 38,887,875 T306S possibly damaging Het
Fbxl5 T C 5: 43,758,241 I610V probably benign Het
Glb1l T A 1: 75,209,440 M1L probably benign Het
Gm14085 A G 2: 122,522,728 Y463C probably damaging Het
Gm5868 A G 5: 72,586,366 L3P probably damaging Het
Hmcn1 T C 1: 150,658,508 K3005R probably benign Het
Homer2 A G 7: 81,611,304 probably null Het
Il1f8 C T 2: 24,158,814 T77M possibly damaging Het
Kcnq3 C A 15: 66,285,815 probably null Het
Mad1l1 C T 5: 140,307,673 R130H probably benign Het
Man2b1 A G 8: 85,084,737 E120G probably damaging Het
Mtus1 T C 8: 41,084,247 D144G probably damaging Het
Olfr1012 T C 2: 85,759,696 I227V possibly damaging Het
Olfr829 T C 9: 18,856,637 I4T probably benign Het
Oprk1 T A 1: 5,602,811 probably benign Het
Rrp12 A G 19: 41,887,148 I252T probably benign Het
Sbno1 A T 5: 124,391,920 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Srpk2 A T 5: 23,540,502 probably benign Het
Tmem2 G T 19: 21,792,652 M1I probably null Het
Ube3b A G 5: 114,393,086 T214A possibly damaging Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zpld1 C G 16: 55,233,518 D304H probably damaging Het
Other mutations in Olfr1023
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01536:Olfr1023 APN 2 85887600 missense probably damaging 1.00
IGL01622:Olfr1023 APN 2 85886962 missense probably benign 0.01
IGL01623:Olfr1023 APN 2 85886962 missense probably benign 0.01
IGL01977:Olfr1023 APN 2 85887367 missense probably damaging 1.00
IGL02057:Olfr1023 APN 2 85886931 missense probably benign 0.00
IGL02555:Olfr1023 APN 2 85887398 missense probably benign 0.34
IGL03133:Olfr1023 APN 2 85887134 missense probably damaging 1.00
IGL03180:Olfr1023 APN 2 85887396 missense probably benign 0.00
R0415:Olfr1023 UTSW 2 85887438 missense possibly damaging 0.94
R1476:Olfr1023 UTSW 2 85887248 nonsense probably null
R1544:Olfr1023 UTSW 2 85887271 missense probably damaging 1.00
R2058:Olfr1023 UTSW 2 85886952 missense possibly damaging 0.48
R5055:Olfr1023 UTSW 2 85887241 missense probably benign 0.12
R5703:Olfr1023 UTSW 2 85887439 missense probably benign 0.06
R6297:Olfr1023 UTSW 2 85886815 missense probably benign 0.35
S24628:Olfr1023 UTSW 2 85887438 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGTACCAGGATGTCCAAGAATG -3'
(R):5'- ACAGACTTCTCTGATGGAGGTC -3'

Sequencing Primer
(F):5'- ACCAGGATGTCCAAGAATGTTTGTG -3'
(R):5'- CTTAAGTACATGCAGAAAAGGGTTCC -3'
Posted On2015-05-15