Incidental Mutation 'R4093:Olfr904'
ID317742
Institutional Source Beutler Lab
Gene Symbol Olfr904
Ensembl Gene ENSMUSG00000094380
Gene Nameolfactory receptor 904
SynonymsGA_x6K02T2PVTD-32156773-32157705, MOR167-3
MMRRC Submission 041627-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4093 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38463144-38468995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38464083 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 14 (L14Q)
Ref Sequence ENSEMBL: ENSMUSP00000057148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058153] [ENSMUST00000216724]
Predicted Effect probably null
Transcript: ENSMUST00000058153
AA Change: L14Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057148
Gene: ENSMUSG00000094380
AA Change: L14Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-51 PFAM
Pfam:7tm_1 41 291 1.5e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216724
AA Change: L14Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6384 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,043,996 M2173V probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Angpt1 T C 15: 42,523,545 T138A probably damaging Het
Atp2c2 G A 8: 119,749,871 probably null Het
C330027C09Rik T C 16: 49,000,976 probably benign Het
Cadm2 A G 16: 66,784,788 V210A possibly damaging Het
Cfap70 A T 14: 20,409,113 D671E probably damaging Het
Chd2 C T 7: 73,501,016 E322K possibly damaging Het
Chrnd C T 1: 87,191,007 Q29* probably null Het
Cym A G 3: 107,214,266 S237P probably benign Het
D030068K23Rik A G 8: 109,251,459 noncoding transcript Het
Gsdma2 T A 11: 98,650,851 S135T probably benign Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hoxb3 C A 11: 96,346,100 H335N probably damaging Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Ighv1-19 G A 12: 114,708,730 T90I probably damaging Het
Kansl3 C A 1: 36,344,954 S729I probably damaging Het
Kcnab1 T C 3: 65,299,614 I137T possibly damaging Het
Kcnt1 A T 2: 25,877,915 E12V probably damaging Het
Klk15 A T 7: 43,938,780 S171C possibly damaging Het
Lcn2 A T 2: 32,387,716 M1K probably null Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp8 T A 4: 107,843,271 C135* probably null Het
Lrrc31 C A 3: 30,695,522 S54I probably damaging Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Med27 G A 2: 29,377,908 probably benign Het
Mical1 T C 10: 41,486,937 probably benign Het
Myt1 A T 2: 181,811,398 M799L probably damaging Het
Nlrc4 T C 17: 74,445,958 M477V probably benign Het
Npy4r T C 14: 34,147,141 I63M probably benign Het
Olfr224 A T 11: 58,566,829 I172N probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr672 C T 7: 104,996,635 G90S probably benign Het
Piezo1 A C 8: 122,501,160 probably null Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Proser1 T C 3: 53,479,712 probably null Het
Psme2 A T 14: 55,588,277 N143K probably benign Het
Pygo2 C A 3: 89,433,264 P323Q probably damaging Het
Rab11b T C 17: 33,749,789 T77A possibly damaging Het
Recql5 A G 11: 115,904,888 S190P probably benign Het
Serpina12 A G 12: 104,037,924 F150L probably damaging Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a2 C T 17: 12,612,394 T357M probably damaging Het
Spag6l A C 16: 16,829,024 N39K probably benign Het
Srl A G 16: 4,497,452 S109P possibly damaging Het
Tagap A T 17: 7,929,423 H152L probably damaging Het
Tbx3 T A 5: 119,680,748 S463T probably benign Het
Tcaf2 A G 6: 42,642,838 L85P probably damaging Het
Tenm4 A T 7: 96,895,772 S2332C probably damaging Het
Trim60 A T 8: 65,001,378 M73K probably benign Het
Trpc1 T C 9: 95,706,865 T769A probably benign Het
Tubgcp4 T A 2: 121,195,477 L601Q probably benign Het
Unc5d T C 8: 28,844,837 Y154C possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Vmn1r57 G T 7: 5,220,857 S127I possibly damaging Het
Vmn1r62 T A 7: 5,675,944 M208K probably damaging Het
Vmn2r110 T C 17: 20,583,380 D311G possibly damaging Het
Vmn2r48 C A 7: 9,942,258 S432I probably benign Het
Vmn2r48 T A 7: 9,942,259 S432C probably damaging Het
Vmn2r71 T C 7: 85,621,234 V536A probably benign Het
Vstm2a A G 11: 16,259,884 T37A probably damaging Het
Wfs1 T C 5: 36,967,465 H694R probably damaging Het
Zdbf2 T C 1: 63,309,781 S2440P possibly damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Other mutations in Olfr904
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Olfr904 APN 9 38464734 missense probably benign
IGL01966:Olfr904 APN 9 38464929 missense possibly damaging 0.82
IGL02328:Olfr904 APN 9 38464676 missense probably benign
IGL03394:Olfr904 APN 9 38464221 missense probably damaging 1.00
R0085:Olfr904 UTSW 9 38464662 missense probably benign 0.37
R0125:Olfr904 UTSW 9 38464461 nonsense probably null
R1506:Olfr904 UTSW 9 38464143 missense probably benign 0.02
R1545:Olfr904 UTSW 9 38464519 missense probably benign 0.37
R1610:Olfr904 UTSW 9 38464631 missense probably damaging 0.97
R2008:Olfr904 UTSW 9 38464241 missense probably damaging 1.00
R2424:Olfr904 UTSW 9 38464832 missense probably damaging 0.99
R3824:Olfr904 UTSW 9 38464526 missense probably benign 0.13
R3964:Olfr904 UTSW 9 38464683 missense probably benign 0.25
R4454:Olfr904 UTSW 9 38464642 missense probably benign 0.03
R5650:Olfr904 UTSW 9 38464727 nonsense probably null
R6921:Olfr904 UTSW 9 38464247 missense probably benign 0.01
R7406:Olfr904 UTSW 9 38464143 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTATATGCTCACGTGGGGC -3'
(R):5'- CTTGCTCAGTATAAAGTTCATCAGC -3'

Sequencing Primer
(F):5'- GTGGGGCTAATCTCACACATACTC -3'
(R):5'- CAGCATTTTTGGAGTGAACACAG -3'
Posted On2015-05-15