Incidental Mutation 'R4093:Chd2'
ID317734
Institutional Source Beutler Lab
Gene Symbol Chd2
Ensembl Gene ENSMUSG00000078671
Gene Namechromodomain helicase DNA binding protein 2
Synonyms2810040A01Rik, 2810013C04Rik, 5630401D06Rik
MMRRC Submission 041627-MU
Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R4093 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location73426638-73541830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73501016 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 322 (E322K)
Ref Sequence ENSEMBL: ENSMUSP00000026895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026895] [ENSMUST00000169922] [ENSMUST00000199601] [ENSMUST00000199641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026895
AA Change: E322K

PolyPhen 2 Score 0.701 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026895
Gene: ENSMUSG00000078671
AA Change: E322K

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 146 160 N/A INTRINSIC
low complexity region 199 208 N/A INTRINSIC
CHROMO 224 310 2.3e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169922
AA Change: E358K

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: E358K

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199601
SMART Domains Protein: ENSMUSP00000143203
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
CHROMO 2 65 8.1e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199641
AA Change: E50K

PolyPhen 2 Score 0.398 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142848
Gene: ENSMUSG00000078671
AA Change: E50K

DomainStartEndE-ValueType
CHROMO 1 38 1.2e-2 SMART
CHROMO 68 119 1.6e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206665
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (69/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]
Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,043,996 M2173V probably damaging Het
Alas1 G T 9: 106,241,801 probably null Het
Angpt1 T C 15: 42,523,545 T138A probably damaging Het
Atp2c2 G A 8: 119,749,871 probably null Het
C330027C09Rik T C 16: 49,000,976 probably benign Het
Cadm2 A G 16: 66,784,788 V210A possibly damaging Het
Cfap70 A T 14: 20,409,113 D671E probably damaging Het
Chrnd C T 1: 87,191,007 Q29* probably null Het
Cym A G 3: 107,214,266 S237P probably benign Het
D030068K23Rik A G 8: 109,251,459 noncoding transcript Het
Gsdma2 T A 11: 98,650,851 S135T probably benign Het
Hc A T 2: 34,983,807 Y158* probably null Het
Hoxb3 C A 11: 96,346,100 H335N probably damaging Het
Htr2a G A 14: 74,706,349 M456I probably benign Het
Ighv1-19 G A 12: 114,708,730 T90I probably damaging Het
Kansl3 C A 1: 36,344,954 S729I probably damaging Het
Kcnab1 T C 3: 65,299,614 I137T possibly damaging Het
Kcnt1 A T 2: 25,877,915 E12V probably damaging Het
Klk15 A T 7: 43,938,780 S171C possibly damaging Het
Lcn2 A T 2: 32,387,716 M1K probably null Het
Lrig1 T C 6: 94,613,578 D487G probably benign Het
Lrp8 T A 4: 107,843,271 C135* probably null Het
Lrrc31 C A 3: 30,695,522 S54I probably damaging Het
Ltbp4 A G 7: 27,325,216 V663A possibly damaging Het
Med27 G A 2: 29,377,908 probably benign Het
Mical1 T C 10: 41,486,937 probably benign Het
Myt1 A T 2: 181,811,398 M799L probably damaging Het
Nlrc4 T C 17: 74,445,958 M477V probably benign Het
Npy4r T C 14: 34,147,141 I63M probably benign Het
Olfr224 A T 11: 58,566,829 I172N probably damaging Het
Olfr282 T C 15: 98,437,682 L71P probably damaging Het
Olfr672 C T 7: 104,996,635 G90S probably benign Het
Olfr904 T A 9: 38,464,083 L14Q probably null Het
Piezo1 A C 8: 122,501,160 probably null Het
Ppp1r12c T C 7: 4,483,367 E601G probably damaging Het
Proser1 T C 3: 53,479,712 probably null Het
Psme2 A T 14: 55,588,277 N143K probably benign Het
Pygo2 C A 3: 89,433,264 P323Q probably damaging Het
Rab11b T C 17: 33,749,789 T77A possibly damaging Het
Recql5 A G 11: 115,904,888 S190P probably benign Het
Serpina12 A G 12: 104,037,924 F150L probably damaging Het
Sfswap A G 5: 129,560,741 S821G possibly damaging Het
Slc22a2 C T 17: 12,612,394 T357M probably damaging Het
Spag6l A C 16: 16,829,024 N39K probably benign Het
Srl A G 16: 4,497,452 S109P possibly damaging Het
Tagap A T 17: 7,929,423 H152L probably damaging Het
Tbx3 T A 5: 119,680,748 S463T probably benign Het
Tcaf2 A G 6: 42,642,838 L85P probably damaging Het
Tenm4 A T 7: 96,895,772 S2332C probably damaging Het
Trim60 A T 8: 65,001,378 M73K probably benign Het
Trpc1 T C 9: 95,706,865 T769A probably benign Het
Tubgcp4 T A 2: 121,195,477 L601Q probably benign Het
Unc5d T C 8: 28,844,837 Y154C possibly damaging Het
Vmn1r185 A T 7: 26,611,783 V99E probably damaging Het
Vmn1r57 G T 7: 5,220,857 S127I possibly damaging Het
Vmn1r62 T A 7: 5,675,944 M208K probably damaging Het
Vmn2r110 T C 17: 20,583,380 D311G possibly damaging Het
Vmn2r48 C A 7: 9,942,258 S432I probably benign Het
Vmn2r48 T A 7: 9,942,259 S432C probably damaging Het
Vmn2r71 T C 7: 85,621,234 V536A probably benign Het
Vstm2a A G 11: 16,259,884 T37A probably damaging Het
Wfs1 T C 5: 36,967,465 H694R probably damaging Het
Zdbf2 T C 1: 63,309,781 S2440P possibly damaging Het
Zfp61 A G 7: 24,291,275 probably null Het
Zfp64 T C 2: 168,925,935 T586A probably benign Het
Zfp943 T A 17: 21,992,982 C350S probably damaging Het
Other mutations in Chd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Chd2 APN 7 73468577 missense probably damaging 0.99
IGL00535:Chd2 APN 7 73540828 missense probably benign 0.01
IGL00961:Chd2 APN 7 73444249 missense probably damaging 0.99
IGL01092:Chd2 APN 7 73441686 missense possibly damaging 0.69
IGL02035:Chd2 APN 7 73441627 intron probably null
IGL02083:Chd2 APN 7 73481068 missense possibly damaging 0.95
IGL02205:Chd2 APN 7 73441717 missense probably benign 0.01
IGL02243:Chd2 APN 7 73497708 unclassified probably null
IGL02385:Chd2 APN 7 73435822 missense probably damaging 1.00
IGL02552:Chd2 APN 7 73447320 unclassified probably benign
IGL02590:Chd2 APN 7 73453200 missense probably benign 0.00
IGL02684:Chd2 APN 7 73475349 missense probably damaging 0.99
IGL02731:Chd2 APN 7 73493456 missense probably damaging 0.99
IGL03272:Chd2 APN 7 73453166 missense possibly damaging 0.94
1mM(1):Chd2 UTSW 7 73502104 missense possibly damaging 0.65
A4554:Chd2 UTSW 7 73480968 missense probably benign
F6893:Chd2 UTSW 7 73507872 missense possibly damaging 0.92
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0068:Chd2 UTSW 7 73484534 missense probably damaging 1.00
R0763:Chd2 UTSW 7 73447274 missense possibly damaging 0.74
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0974:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R1223:Chd2 UTSW 7 73484517 missense probably damaging 1.00
R1435:Chd2 UTSW 7 73453136 missense probably damaging 0.99
R1527:Chd2 UTSW 7 73490614 nonsense probably null
R1599:Chd2 UTSW 7 73473051 missense probably benign 0.05
R1657:Chd2 UTSW 7 73480430 missense probably damaging 1.00
R1932:Chd2 UTSW 7 73454445 missense probably damaging 0.99
R2110:Chd2 UTSW 7 73429987 missense probably benign 0.00
R2202:Chd2 UTSW 7 73478668 missense probably benign 0.00
R2383:Chd2 UTSW 7 73503420 missense possibly damaging 0.89
R2393:Chd2 UTSW 7 73507883 missense possibly damaging 0.92
R3699:Chd2 UTSW 7 73468490 missense probably benign 0.35
R3713:Chd2 UTSW 7 73471790 unclassified probably benign
R3788:Chd2 UTSW 7 73447130 unclassified probably benign
R3826:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3828:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3830:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3966:Chd2 UTSW 7 73464395 splice site probably benign
R4431:Chd2 UTSW 7 73435961 missense possibly damaging 0.56
R4461:Chd2 UTSW 7 73540874 intron probably benign
R4782:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4791:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4792:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4799:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4832:Chd2 UTSW 7 73502125 missense probably damaging 1.00
R5055:Chd2 UTSW 7 73480508 missense probably damaging 1.00
R5071:Chd2 UTSW 7 73429689 missense probably benign 0.03
R5328:Chd2 UTSW 7 73463681 missense possibly damaging 0.96
R5444:Chd2 UTSW 7 73473085 missense probably damaging 1.00
R5643:Chd2 UTSW 7 73484484 missense probably damaging 1.00
R5666:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5670:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5706:Chd2 UTSW 7 73491357 missense possibly damaging 0.74
R5825:Chd2 UTSW 7 73484602 splice site probably null
R5834:Chd2 UTSW 7 73478715 missense probably damaging 1.00
R5920:Chd2 UTSW 7 73537312 missense probably damaging 0.97
R6051:Chd2 UTSW 7 73435842 missense probably benign 0.00
R6179:Chd2 UTSW 7 73444323 missense probably damaging 0.98
R6229:Chd2 UTSW 7 73451723 missense possibly damaging 0.76
R6267:Chd2 UTSW 7 73463671 missense probably damaging 0.99
R6310:Chd2 UTSW 7 73453164 missense probably damaging 1.00
R6439:Chd2 UTSW 7 73480406 missense probably damaging 1.00
R6444:Chd2 UTSW 7 73501037 critical splice acceptor site probably null
R6529:Chd2 UTSW 7 73503443 missense possibly damaging 0.89
R6611:Chd2 UTSW 7 73493565 missense probably damaging 0.99
R6661:Chd2 UTSW 7 73490482 missense possibly damaging 0.95
R6782:Chd2 UTSW 7 73475379 nonsense probably null
R6860:Chd2 UTSW 7 73497810 missense possibly damaging 0.95
R6955:Chd2 UTSW 7 73475423 missense probably damaging 1.00
R6984:Chd2 UTSW 7 73484411 nonsense probably null
R7095:Chd2 UTSW 7 73471881 missense probably damaging 1.00
R7121:Chd2 UTSW 7 73469670 missense probably benign 0.00
R7179:Chd2 UTSW 7 73475420 missense probably damaging 1.00
R7500:Chd2 UTSW 7 73451808 missense probably damaging 1.00
X0025:Chd2 UTSW 7 73507837 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCAGCCCTCAAATAATGCTTG -3'
(R):5'- TGCAGAGCCAATGTCAAGAAC -3'

Sequencing Primer
(F):5'- GGAAACCTTGGAACCAATATCCTTG -3'
(R):5'- CAATTTGCAGAAATGTTTTTGTTGG -3'
Posted On2015-05-15