Incidental Mutation 'R1961:Tox'
ID317908
Institutional Source Beutler Lab
Gene Symbol Tox
Ensembl Gene ENSMUSG00000041272
Gene Namethymocyte selection-associated high mobility group box
Synonyms1700007F02Rik
MMRRC Submission 039975-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1961 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location6686353-6991557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6688886 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 493 (V493L)
Ref Sequence ENSEMBL: ENSMUSP00000037966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039987]
PDB Structure
Solution structure of the HMG_box domain of thymus high mobility group box protein TOX from mouse [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000039987
AA Change: V493L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037966
Gene: ENSMUSG00000041272
AA Change: V493L

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
HMG 260 330 1.11e-19 SMART
low complexity region 416 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137749
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 99% (93/94)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a HMG box DNA binding domain. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. This protein may function to regulate T-cell development.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele have a severe block in thymic positive selection leading to loss of CD4 T lineage cells, and display decreased NK cell numbers, severely reduced numbers of lymphoid tissue inducer cells, absence of all peripheral lymph nodes, and loss of Peyer's patches. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A G 6: 96,165,269 S265P possibly damaging Het
3110001I22Rik T A 16: 13,677,728 H230Q probably benign Het
Abcc1 T C 16: 14,396,393 Y191H probably damaging Het
Abcc4 C A 14: 118,611,456 G495C probably damaging Het
Abcc4 C A 14: 118,611,459 V494L possibly damaging Het
Acsm4 T C 7: 119,708,740 Y367H probably benign Het
Adam21 A T 12: 81,559,508 Y493* probably null Het
Add2 T C 6: 86,096,756 F209S probably damaging Het
Adgre4 T C 17: 55,791,497 S136P probably benign Het
Aff4 T G 11: 53,372,999 L282R probably damaging Het
Akt3 A G 1: 177,096,995 I178T probably damaging Het
Ap3m1 T C 14: 21,041,015 Y174C probably damaging Het
Atl1 A G 12: 69,953,500 E308G probably benign Het
Atp8b5 T G 4: 43,369,688 V942G probably damaging Het
B3gntl1 A G 11: 121,644,525 probably null Het
Btrc T G 19: 45,527,343 I480S probably damaging Het
Cacna1c A T 6: 118,630,322 I1366N probably benign Het
Ccdc113 T A 8: 95,540,831 N141K probably benign Het
Ccdc167 T C 17: 29,704,431 N77D possibly damaging Het
Ccser1 T C 6: 61,313,646 probably benign Het
Cenpe A G 3: 135,242,493 E1230G probably damaging Het
Clec12a A C 6: 129,350,481 T21P possibly damaging Het
Cyp26c1 T A 19: 37,687,377 F230I probably damaging Het
Exog A G 9: 119,452,266 E190G possibly damaging Het
Fam162b A G 10: 51,590,334 W30R probably benign Het
Fam172a C A 13: 77,902,720 H50N probably benign Het
Fndc3b G A 3: 27,456,451 Q841* probably null Het
Frzb T A 2: 80,424,601 Y197F probably benign Het
G530012D18Rik CAGAGAGA CAGAGAGAGA 1: 85,577,224 probably null Het
Gabrb1 G A 5: 71,700,336 R43Q probably benign Het
Gm21060 A T 19: 61,297,007 H21Q possibly damaging Het
Gm4825 A G 15: 85,511,044 noncoding transcript Het
Gm5581 A C 6: 131,168,162 noncoding transcript Het
Gm9894 T C 13: 67,763,915 noncoding transcript Het
Gpr15 T A 16: 58,718,007 I240L probably benign Het
Gria4 A T 9: 4,519,546 probably benign Het
Grid2 T C 6: 63,908,893 L91S probably damaging Het
Igsf5 A C 16: 96,378,351 T215P probably damaging Het
Kif13a G A 13: 46,864,838 probably benign Het
Kif21a G A 15: 90,970,848 A703V probably damaging Het
Kif27 T G 13: 58,293,123 R1159S probably benign Het
Kifc2 T A 15: 76,662,825 L226H probably damaging Het
Klf10 T C 15: 38,295,996 H435R probably damaging Het
Masp1 T C 16: 23,452,932 Y623C probably damaging Het
Megf10 T A 18: 57,212,354 C118S probably damaging Het
Mical3 A G 6: 120,982,607 V909A possibly damaging Het
Mmrn2 A G 14: 34,398,475 probably null Het
Mpeg1 G A 19: 12,462,911 V578M probably damaging Het
Nlrp2 T C 7: 5,327,738 E553G probably damaging Het
Nmi A T 2: 51,948,620 S301T probably benign Het
Nr2f2 G T 7: 70,358,155 T193K possibly damaging Het
Ntng2 T C 2: 29,197,098 N404S probably damaging Het
Olfr54 T G 11: 51,027,475 S158A probably benign Het
Olfr594 T C 7: 103,219,997 V93A probably benign Het
Oplah G A 15: 76,297,464 T1119I probably damaging Het
Otoa T A 7: 121,118,569 D336E probably benign Het
Pde4b A G 4: 102,597,460 E108G probably damaging Het
Pdgfrb G A 18: 61,061,505 R118H possibly damaging Het
Phactr4 G A 4: 132,377,248 T256I probably benign Het
Pla2g3 C T 11: 3,490,983 T316I probably benign Het
Plekhg4 A G 8: 105,381,464 E982G probably damaging Het
Pmfbp1 T G 8: 109,530,144 probably benign Het
Pot1b A T 17: 55,662,531 Y546N probably damaging Het
Rab11fip5 C A 6: 85,348,991 Q144H possibly damaging Het
Reep3 A T 10: 67,039,499 probably null Het
Rgl2 T C 17: 33,933,615 L400P probably damaging Het
Rnf122 A G 8: 31,124,846 probably benign Het
Scgb1b21 G T 7: 33,527,378 noncoding transcript Het
Sec63 A T 10: 42,823,886 K647N probably damaging Het
Sema4a C T 3: 88,438,176 probably benign Het
Serpinf1 C T 11: 75,416,419 V31I probably benign Het
Sez6l C T 5: 112,424,615 probably benign Het
Shank3 T C 15: 89,557,964 S1612P possibly damaging Het
Slc19a3 G A 1: 83,022,798 T166M probably benign Het
Slc22a29 C A 19: 8,169,193 R415M probably benign Het
Slc38a11 A T 2: 65,330,339 F304I possibly damaging Het
Slitrk1 T A 14: 108,912,190 N363I probably damaging Het
Slx4ip A G 2: 137,067,681 T129A probably benign Het
Spop T C 11: 95,491,711 V332A possibly damaging Het
Sptlc1 A C 13: 53,358,880 D147E probably benign Het
Tnpo1 T C 13: 98,852,932 Y754C probably damaging Het
Ttbk1 A C 17: 46,480,224 F45V probably damaging Het
Ttc27 T A 17: 74,780,856 M472K probably damaging Het
Ttll7 A G 3: 146,915,795 probably benign Het
Ttn A T 2: 76,721,760 C22851S probably benign Het
Ttn T A 2: 76,798,212 M14535L possibly damaging Het
Txlna T C 4: 129,640,262 T54A probably benign Het
Usp33 T C 3: 152,380,628 V668A probably damaging Het
Vmn2r28 C A 7: 5,481,071 C710F possibly damaging Het
Vmn2r8 T A 5: 108,798,095 M549L probably benign Het
Vwa5b2 T C 16: 20,602,191 probably null Het
Wnk1 T C 6: 119,969,247 I648M probably damaging Het
Other mutations in Tox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Tox APN 4 6697583 missense probably damaging 0.99
IGL01481:Tox APN 4 6842396 missense probably damaging 0.99
IGL01600:Tox APN 4 6697585 missense probably damaging 0.98
IGL01616:Tox APN 4 6688430 missense probably damaging 0.99
IGL02160:Tox APN 4 6711537 missense probably damaging 0.99
IGL02390:Tox APN 4 6697534 missense possibly damaging 0.90
IGL03243:Tox APN 4 6697597 missense possibly damaging 0.76
R0008:Tox UTSW 4 6842411 missense probably benign 0.41
R0008:Tox UTSW 4 6842411 missense probably benign 0.41
R1147:Tox UTSW 4 6823055 missense possibly damaging 0.74
R1147:Tox UTSW 4 6823055 missense possibly damaging 0.74
R1159:Tox UTSW 4 6697600 missense probably benign 0.37
R1903:Tox UTSW 4 6688948 missense probably damaging 0.99
R2484:Tox UTSW 4 6688886 missense probably damaging 0.96
R3692:Tox UTSW 4 6697535 missense probably benign 0.05
R4072:Tox UTSW 4 6842396 missense probably damaging 0.99
R4635:Tox UTSW 4 6990501 utr 5 prime probably benign
R4815:Tox UTSW 4 6823033 missense probably benign
R5099:Tox UTSW 4 6688958 missense probably benign 0.28
R5421:Tox UTSW 4 6842409 missense possibly damaging 0.79
R5537:Tox UTSW 4 6697510 missense probably damaging 1.00
R5630:Tox UTSW 4 6688835 small insertion probably benign
R5883:Tox UTSW 4 6697444 missense probably benign
R6351:Tox UTSW 4 6697439 missense probably benign
R6351:Tox UTSW 4 6741536 missense probably benign 0.11
R6448:Tox UTSW 4 6822975 missense probably benign 0.08
R6934:Tox UTSW 4 6697635 missense probably damaging 0.98
Z1088:Tox UTSW 4 6688450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACTAGAAGATGATGGCTCTAC -3'
(R):5'- ACAGAAGTGAGGTGGCCTAC -3'

Sequencing Primer
(F):5'- AGAAGATGATGGCTCTACATTTTATG -3'
(R):5'- CTACCATATTTGCGGGTGTGGATAAC -3'
Posted On2015-05-19