Incidental Mutation 'R4202:Ano7'
ID318780
Institutional Source Beutler Lab
Gene Symbol Ano7
Ensembl Gene ENSMUSG00000034107
Gene Nameanoctamin 7
SynonymsTmem16g, NGEP-L, IPCA-5, NGEP, Pcanap5
MMRRC Submission 041032-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock #R4202 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location93373930-93404303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93380478 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000140438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058682] [ENSMUST00000186641]
Predicted Effect probably benign
Transcript: ENSMUST00000058682
AA Change: D77G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000050495
Gene: ENSMUSG00000034107
AA Change: D77G

DomainStartEndE-ValueType
Pfam:Anoct_dimer 49 274 2.2e-63 PFAM
Pfam:Anoctamin 277 824 3.4e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186641
AA Change: D77G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140438
Gene: ENSMUSG00000034107
AA Change: D77G

DomainStartEndE-ValueType
Pfam:Anoctamin 277 825 6.6e-150 PFAM
Meta Mutation Damage Score 0.034 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 92% (33/36)
MGI Phenotype FUNCTION: This gene encodes a member of the anoctamin family, which in mammals is comprised of 10 members. Anoctamin proteins are proposed to have eight transmembrane domains with both termini facing the cytoplasm and a C-terminal domain of unknown function. While some members have been characterized as calcium-activated chloride channels, this protein is reported to have little anion conductance activity. In humans, this protein is primarily found in prostate tissues and may serve as a target for prostate cancer immunotherapy. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adsl C T 15: 80,952,216 T58I probably damaging Het
Ap2b1 T A 11: 83,335,604 probably null Het
Bclaf3 T A X: 159,553,833 S419T probably damaging Het
Bysl A G 17: 47,604,326 S166P probably benign Het
Cd101 A C 3: 101,018,685 D239E probably damaging Het
Cdc42bpb G A 12: 111,294,139 P1702S probably benign Het
Cfap65 G T 1: 74,920,542 F816L probably damaging Het
Cnot6 T C 11: 49,702,636 Y6C probably damaging Het
Csrp1 T G 1: 135,745,327 C61G probably damaging Het
Gmeb2 A G 2: 181,253,973 V468A possibly damaging Het
Gucy2g A G 19: 55,229,769 S416P possibly damaging Het
Hormad1 G A 3: 95,585,198 R362H probably benign Het
Lancl2 T A 6: 57,712,992 V61D probably benign Het
Lta4h A G 10: 93,470,807 D287G probably damaging Het
Maml1 A T 11: 50,257,913 L1000Q probably damaging Het
Olfr776 T C 10: 129,261,777 V272A probably benign Het
Olfr8 T C 10: 78,955,295 V30A probably benign Het
Osbpl9 G T 4: 109,172,240 probably benign Het
Oser1 T C 2: 163,411,455 T45A probably benign Het
Ppfibp1 C A 6: 147,029,581 S878R probably damaging Het
Prss43 T A 9: 110,827,461 V72D probably benign Het
Sdhb T A 4: 140,979,068 M272K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tas2r138 T C 6: 40,612,476 M279V possibly damaging Het
Tmem55b A G 14: 50,930,655 S41P probably damaging Het
Tsku C T 7: 98,352,998 R42H probably damaging Het
Tyr A G 7: 87,429,068 L528P possibly damaging Het
Vmn2r87 T C 10: 130,472,579 I597V probably benign Het
Wnt5b T C 6: 119,440,311 N198D probably damaging Het
Other mutations in Ano7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ano7 APN 1 93402166 missense probably benign 0.04
IGL00838:Ano7 APN 1 93402757 missense possibly damaging 0.91
IGL01295:Ano7 APN 1 93380478 missense probably benign 0.00
IGL01322:Ano7 APN 1 93395508 missense probably benign 0.08
IGL01807:Ano7 APN 1 93402696 missense possibly damaging 0.66
IGL01859:Ano7 APN 1 93394446 missense probably damaging 1.00
IGL02349:Ano7 APN 1 93391490 missense probably benign 0.02
IGL02976:Ano7 APN 1 93402673 missense possibly damaging 0.78
R0360:Ano7 UTSW 1 93388658 missense probably benign 0.01
R0364:Ano7 UTSW 1 93388658 missense probably benign 0.01
R0528:Ano7 UTSW 1 93395502 missense probably null 1.00
R0741:Ano7 UTSW 1 93401587 missense probably damaging 0.97
R1131:Ano7 UTSW 1 93401776 missense probably benign 0.24
R1156:Ano7 UTSW 1 93401852 unclassified probably null
R1500:Ano7 UTSW 1 93397328 missense probably damaging 1.00
R1710:Ano7 UTSW 1 93385624 missense probably benign 0.00
R2002:Ano7 UTSW 1 93400581 unclassified probably benign
R2062:Ano7 UTSW 1 93390313 missense probably benign
R2120:Ano7 UTSW 1 93402133 splice site probably benign
R2200:Ano7 UTSW 1 93380436 missense possibly damaging 0.93
R2268:Ano7 UTSW 1 93380439 missense possibly damaging 0.51
R2763:Ano7 UTSW 1 93399186 splice site probably null
R4204:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4205:Ano7 UTSW 1 93380478 missense probably benign 0.00
R4453:Ano7 UTSW 1 93394353 missense probably damaging 1.00
R4627:Ano7 UTSW 1 93375185 missense probably benign 0.15
R4735:Ano7 UTSW 1 93400494 missense probably benign
R4809:Ano7 UTSW 1 93394566 missense probably benign 0.20
R4935:Ano7 UTSW 1 93395314 missense possibly damaging 0.48
R4970:Ano7 UTSW 1 93397363 missense possibly damaging 0.77
R5112:Ano7 UTSW 1 93397363 missense possibly damaging 0.77
R5249:Ano7 UTSW 1 93375196 missense probably benign
R5813:Ano7 UTSW 1 93384919 critical splice donor site probably null
R6181:Ano7 UTSW 1 93395359 missense probably damaging 1.00
R7113:Ano7 UTSW 1 93385620 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GAAACCCATGGCTCTCACTTC -3'
(R):5'- TGCTTCATATCCTTGGGCAG -3'

Sequencing Primer
(F):5'- GCATCCCTGCTGAGACCAC -3'
(R):5'- TCATATCCTTGGGCAGTAAGC -3'
Posted On2015-06-10