Incidental Mutation 'R4334:Gpatch3'
ID323687
Institutional Source Beutler Lab
Gene Symbol Gpatch3
Ensembl Gene ENSMUSG00000028850
Gene NameG patch domain containing 3
SynonymsGpatc3, D930035B09Rik
MMRRC Submission 041664-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R4334 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location133574745-133584243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133582481 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 375 (D375G)
Ref Sequence ENSEMBL: ENSMUSP00000030662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030661] [ENSMUST00000030662] [ENSMUST00000105899]
Predicted Effect probably benign
Transcript: ENSMUST00000030661
SMART Domains Protein: ENSMUSP00000030661
Gene: ENSMUSG00000028848

DomainStartEndE-ValueType
Pfam:ATP_bind_1 14 261 6.6e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030662
AA Change: D375G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030662
Gene: ENSMUSG00000028850
AA Change: D375G

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
low complexity region 274 305 N/A INTRINSIC
G_patch 409 457 1.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105899
SMART Domains Protein: ENSMUSP00000101519
Gene: ENSMUSG00000028848

DomainStartEndE-ValueType
Pfam:ATP_bind_1 14 117 9.2e-42 PFAM
Pfam:ATP_bind_1 115 238 4.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154648
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,318,268 V447E probably damaging Het
Adcyap1 T C 17: 93,202,268 L49P probably benign Het
B4galt4 T C 16: 38,752,259 I102T probably damaging Het
Cc2d2a A G 5: 43,683,134 D110G probably benign Het
Ccdc141 C T 2: 77,170,432 V19I probably damaging Het
Ccdc39 A G 3: 33,837,882 L147P probably damaging Het
Cdc5l A T 17: 45,410,786 D519E probably benign Het
Cdh23 G T 10: 60,385,059 T1305K probably damaging Het
Cfi T A 3: 129,850,829 V158D possibly damaging Het
Clstn2 T G 9: 97,463,528 Y589S probably damaging Het
Dsp A G 13: 38,196,664 K1863E possibly damaging Het
Enpp3 A T 10: 24,793,589 M491K probably damaging Het
Fhdc1 C A 3: 84,444,826 V1031F probably benign Het
Fkbp15 G A 4: 62,303,219 A1170V possibly damaging Het
Foxa2 T C 2: 148,044,703 N64S possibly damaging Het
Foxm1 T C 6: 128,365,967 I88T probably damaging Het
Gm3173 A T 14: 4,514,779 I8L possibly damaging Het
Herc2 T C 7: 56,226,654 F4436L probably damaging Het
Htr3b G A 9: 48,945,509 A223V probably damaging Het
Iars2 T A 1: 185,303,394 T550S probably benign Het
Igsf9 A T 1: 172,494,212 K149* probably null Het
Khnyn A G 14: 55,894,042 D536G probably damaging Het
Kng1 T C 16: 23,079,620 V409A possibly damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
Madd C T 2: 91,140,572 V1508I probably benign Het
Micall2 T C 5: 139,713,350 E527G probably damaging Het
Myo7b A G 18: 31,976,987 S1141P probably damaging Het
Ncoa2 G A 1: 13,174,963 P504S possibly damaging Het
Notch1 G A 2: 26,460,036 T2364I probably benign Het
Pde4c T A 8: 70,749,826 probably null Het
Pik3cb A G 9: 99,061,851 L633P probably damaging Het
Ranbp2 T A 10: 58,463,994 D483E probably damaging Het
Sh3tc2 A G 18: 61,990,321 N718D probably damaging Het
Spast G A 17: 74,352,015 A126T probably damaging Het
Ssc5d T C 7: 4,943,664 S1006P probably benign Het
Tmprss6 T A 15: 78,459,427 probably null Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Unc79 C T 12: 103,078,974 T803M probably benign Het
Vmn2r118 A T 17: 55,610,347 F388L possibly damaging Het
Vmn2r71 T C 7: 85,619,834 V415A probably benign Het
Wdr4 A T 17: 31,499,152 F316Y possibly damaging Het
Zfp810 T C 9: 22,278,784 Y276C probably benign Het
Other mutations in Gpatch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Gpatch3 APN 4 133580717 unclassified probably benign
IGL02876:Gpatch3 APN 4 133580684 missense probably damaging 1.00
IGL03181:Gpatch3 APN 4 133578122 missense probably damaging 1.00
ANU23:Gpatch3 UTSW 4 133578302 small deletion probably benign
PIT4585001:Gpatch3 UTSW 4 133583086 missense probably damaging 0.99
R0358:Gpatch3 UTSW 4 133577904 splice site probably null
R0383:Gpatch3 UTSW 4 133578146 missense probably damaging 1.00
R1706:Gpatch3 UTSW 4 133575173 nonsense probably null
R2269:Gpatch3 UTSW 4 133583807 missense possibly damaging 0.83
R3788:Gpatch3 UTSW 4 133575168 missense possibly damaging 0.93
R4030:Gpatch3 UTSW 4 133578147 missense possibly damaging 0.94
R4718:Gpatch3 UTSW 4 133582544 missense probably benign 0.37
R5036:Gpatch3 UTSW 4 133578150 missense probably damaging 1.00
R6032:Gpatch3 UTSW 4 133578306 missense probably benign 0.06
R6032:Gpatch3 UTSW 4 133578306 missense probably benign 0.06
R6572:Gpatch3 UTSW 4 133574880 missense probably damaging 1.00
R6923:Gpatch3 UTSW 4 133582525 missense probably damaging 1.00
R7106:Gpatch3 UTSW 4 133578203 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCTCATCTGGAAGAAGAGAGCC -3'
(R):5'- AAGTGGCTCAAGTGTGGCAG -3'

Sequencing Primer
(F):5'- AAGAGAGCCAAGGTTCCTGTTCC -3'
(R):5'- CACACTCACTTACCTTGGT -3'
Posted On2015-06-24