Incidental Mutation 'R4346:Plxnd1'
ID 324331
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms 6230425C21Rik, b2b1863Clo, b2b553Clo
MMRRC Submission 041667-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4346 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 115931772-115971966 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115954941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 607 (V607A)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect probably benign
Transcript: ENSMUST00000015511
AA Change: V607A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: V607A

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Meta Mutation Damage Score 0.0776 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (31/31)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a G A 2: 154,887,651 (GRCm39) R37Q probably benign Het
Adam12 T C 7: 133,583,264 (GRCm39) T128A possibly damaging Het
Dnah8 A T 17: 30,944,072 (GRCm39) Q1763L possibly damaging Het
Dvl3 G A 16: 20,350,049 (GRCm39) R645H possibly damaging Het
Egflam A T 15: 7,263,759 (GRCm39) C730* probably null Het
Fbxo40 T C 16: 36,790,525 (GRCm39) E195G probably benign Het
Frmd4a T C 2: 4,612,844 (GRCm39) S1025P possibly damaging Het
Gba2 A G 4: 43,571,337 (GRCm39) V204A probably benign Het
Igkv8-28 C T 6: 70,121,096 (GRCm39) probably benign Het
Lef1 T C 3: 130,988,357 (GRCm39) M308T probably damaging Het
Map1a A G 2: 121,131,806 (GRCm39) N874S probably benign Het
Med12l A T 3: 58,938,976 (GRCm39) T37S probably damaging Het
Ogfod2 A G 5: 124,251,357 (GRCm39) Y57C probably damaging Het
Or5b94 A G 19: 12,651,592 (GRCm39) T8A probably benign Het
Pnpt1 A G 11: 29,095,478 (GRCm39) D409G probably damaging Het
Pycr3 G A 15: 75,790,580 (GRCm39) T93I probably damaging Het
Ros1 A G 10: 52,044,705 (GRCm39) Y201H possibly damaging Het
Scart2 G A 7: 139,827,878 (GRCm39) V29M probably damaging Het
Slc25a54 A G 3: 109,010,055 (GRCm39) T185A possibly damaging Het
Smarcc2 A G 10: 128,304,692 (GRCm39) I221V probably benign Het
Tnfrsf19 C A 14: 61,209,429 (GRCm39) probably null Het
Ttll11 T C 2: 35,674,130 (GRCm39) N599S probably benign Het
Ttn T G 2: 76,638,926 (GRCm39) I13919L probably damaging Het
Vmn2r63 A G 7: 42,577,537 (GRCm39) F334L possibly damaging Het
Vps13d A G 4: 144,799,099 (GRCm39) probably benign Het
Zfp646 A G 7: 127,478,681 (GRCm39) Y286C probably damaging Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115,944,933 (GRCm39) missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115,946,906 (GRCm39) missense probably benign
IGL01323:Plxnd1 APN 6 115,943,760 (GRCm39) missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115,937,488 (GRCm39) missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115,936,896 (GRCm39) missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115,955,218 (GRCm39) missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115,970,589 (GRCm39) missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115,940,874 (GRCm39) missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115,932,703 (GRCm39) makesense probably null
IGL02873:Plxnd1 APN 6 115,936,937 (GRCm39) missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115,939,318 (GRCm39) missense probably damaging 1.00
Hiss UTSW 6 115,946,890 (GRCm39) missense possibly damaging 0.94
murmer UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
mutter UTSW 6 115,945,005 (GRCm39) missense probably benign 0.27
rattle UTSW 6 115,936,755 (GRCm39) missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115,946,421 (GRCm39) missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115,935,660 (GRCm39) splice site probably benign
R0648:Plxnd1 UTSW 6 115,970,962 (GRCm39) missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115,943,599 (GRCm39) missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115,943,966 (GRCm39) splice site probably null
R1292:Plxnd1 UTSW 6 115,939,644 (GRCm39) unclassified probably benign
R1715:Plxnd1 UTSW 6 115,945,642 (GRCm39) missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115,944,740 (GRCm39) missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115,971,018 (GRCm39) missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115,957,562 (GRCm39) missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115,943,507 (GRCm39) missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115,940,875 (GRCm39) missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115,946,402 (GRCm39) splice site probably null
R1865:Plxnd1 UTSW 6 115,946,402 (GRCm39) splice site probably null
R1875:Plxnd1 UTSW 6 115,955,045 (GRCm39) splice site probably null
R1899:Plxnd1 UTSW 6 115,946,324 (GRCm39) missense probably benign
R1913:Plxnd1 UTSW 6 115,954,978 (GRCm39) missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115,939,478 (GRCm39) missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115,944,216 (GRCm39) missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115,934,509 (GRCm39) missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115,939,725 (GRCm39) missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115,941,105 (GRCm39) missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115,939,704 (GRCm39) missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115,944,709 (GRCm39) critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115,936,276 (GRCm39) missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115,942,914 (GRCm39) missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115,933,056 (GRCm39) splice site probably null
R4280:Plxnd1 UTSW 6 115,933,055 (GRCm39) splice site probably benign
R4439:Plxnd1 UTSW 6 115,970,937 (GRCm39) missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115,932,717 (GRCm39) missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115,945,005 (GRCm39) missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115,971,237 (GRCm39) missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115,949,486 (GRCm39) missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115,935,576 (GRCm39) missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115,935,581 (GRCm39) missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115,937,816 (GRCm39) missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115,932,726 (GRCm39) missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115,971,337 (GRCm39) missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115,942,862 (GRCm39) missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115,935,949 (GRCm39) critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115,934,609 (GRCm39) missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115,942,838 (GRCm39) missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115,945,649 (GRCm39) missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115,944,748 (GRCm39) critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115,955,135 (GRCm39) missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115,954,921 (GRCm39) missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115,955,453 (GRCm39) missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115,953,697 (GRCm39) missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115,946,890 (GRCm39) missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115,970,724 (GRCm39) missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115,949,468 (GRCm39) missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115,937,798 (GRCm39) missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115,953,600 (GRCm39) missense probably benign
R7699:Plxnd1 UTSW 6 115,936,755 (GRCm39) missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115,943,879 (GRCm39) missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115,933,578 (GRCm39) missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115,949,433 (GRCm39) missense probably benign
R8507:Plxnd1 UTSW 6 115,943,866 (GRCm39) missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115,939,768 (GRCm39) missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115,934,558 (GRCm39) missense probably damaging 1.00
R8963:Plxnd1 UTSW 6 115,949,506 (GRCm39) nonsense probably null
R9119:Plxnd1 UTSW 6 115,932,832 (GRCm39) splice site probably benign
R9177:Plxnd1 UTSW 6 115,943,469 (GRCm39) missense probably benign 0.00
R9182:Plxnd1 UTSW 6 115,970,746 (GRCm39) missense probably damaging 0.98
R9185:Plxnd1 UTSW 6 115,934,526 (GRCm39) missense probably damaging 1.00
R9226:Plxnd1 UTSW 6 115,934,524 (GRCm39) missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115,945,754 (GRCm39) missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115,932,730 (GRCm39) missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115,940,277 (GRCm39) missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
R9627:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
R9644:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
R9672:Plxnd1 UTSW 6 115,940,274 (GRCm39) missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115,940,271 (GRCm39) missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115,943,745 (GRCm39) missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115,944,471 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGTCCTAACTGTTGACTAGGTCTTG -3'
(R):5'- CTACTGTGGTTGGTGCACTC -3'

Sequencing Primer
(F):5'- TGACTAGGTCTTGCAAGAGGCC -3'
(R):5'- TTGGTGCACTCTGGAGACC -3'
Posted On 2015-06-24