Incidental Mutation 'R7282:Plxnd1'
ID565726
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Nameplexin D1
Synonymsb2b553Clo, 6230425C21Rik, b2b1863Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7282 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location115954811-115995005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115960837 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1516 (L1516Q)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
Predicted Effect probably damaging
Transcript: ENSMUST00000015511
AA Change: L1516Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: L1516Q

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik C A 11: 58,425,756 D187E probably damaging Het
9530053A07Rik A G 7: 28,144,408 N907S probably benign Het
A830010M20Rik G T 5: 107,507,196 V954L probably benign Het
A830010M20Rik A G 5: 107,510,505 D1647G probably damaging Het
Abl2 T C 1: 156,630,060 Y299H probably damaging Het
Acsl3 T A 1: 78,681,992 N120K probably damaging Het
Aldh1a1 A G 19: 20,629,070 K255R possibly damaging Het
Baz2b C T 2: 59,920,437 R1205H probably benign Het
Carmil1 A G 13: 24,013,404 S1350P probably benign Het
Cecr2 A T 6: 120,761,621 N325I Het
Cep120 C T 18: 53,740,089 A57T probably damaging Het
Chst8 T C 7: 34,748,203 probably null Het
Cntn4 A T 6: 106,525,460 I393F probably damaging Het
Crocc T C 4: 141,022,341 D1494G probably damaging Het
Cwc25 T C 11: 97,748,006 E364G possibly damaging Het
Dnah7a C A 1: 53,684,900 probably null Het
Drg2 A G 11: 60,454,693 E5G probably benign Het
Ehd4 T C 2: 120,091,248 H509R probably damaging Het
Enam A T 5: 88,502,327 N565I probably damaging Het
Evi2a G T 11: 79,527,423 N120K probably benign Het
Faim A G 9: 98,992,126 T2A probably benign Het
Fmnl1 T C 11: 103,196,265 V836A unknown Het
Fosb T C 7: 19,305,188 I224V possibly damaging Het
Frem3 A T 8: 80,612,031 T318S probably damaging Het
Gm13103 A G 4: 143,851,881 N237S possibly damaging Het
Gm9972 G A 11: 43,036,804 G93R unknown Het
Gtf2a1 A T 12: 91,567,835 I215N possibly damaging Het
Hs3st3b1 A G 11: 63,921,571 V106A probably benign Het
Igkv19-93 T C 6: 68,736,501 D48G probably benign Het
Itgb8 A T 12: 119,237,708 W31R probably benign Het
Kmt2d A T 15: 98,854,104 W1995R unknown Het
Lama3 G T 18: 12,439,392 Q551H probably damaging Het
Lama5 T C 2: 180,201,795 Y453C probably damaging Het
Lbhd2 G A 12: 111,410,290 R57H probably damaging Het
Lcmt2 A G 2: 121,138,790 V384A probably damaging Het
Lgsn T G 1: 31,203,371 L178R probably damaging Het
Lhcgr C T 17: 88,758,383 V193I probably benign Het
Lta4h T C 10: 93,453,511 M1T probably null Het
Ly6l T C 15: 75,449,496 S14P probably damaging Het
Met C A 6: 17,547,012 C881* probably null Het
Mettl21e A T 1: 44,210,239 Y86N probably damaging Het
Mgam A T 6: 40,656,512 N251Y possibly damaging Het
Mgam A G 6: 40,763,111 T1673A probably benign Het
Mmp27 T A 9: 7,578,230 V357D probably damaging Het
Muc2 A G 7: 141,752,744 E740G Het
Myoc C A 1: 162,648,844 S372R probably benign Het
Ncor2 A T 5: 125,020,040 M1358K Het
Nol6 A G 4: 41,119,468 S613P probably benign Het
Nuggc T A 14: 65,617,623 I334N probably damaging Het
Nxnl2 C T 13: 51,171,506 P62S probably damaging Het
Ogfod1 C T 8: 94,037,439 H51Y possibly damaging Het
Olfml1 T A 7: 107,590,323 D198E possibly damaging Het
Olfr1395 A C 11: 49,149,118 N287T probably damaging Het
Ovch2 C T 7: 107,794,370 R183H possibly damaging Het
Prrc2c A G 1: 162,679,974 V2448A possibly damaging Het
Rexo5 C T 7: 119,818,413 T212I probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Rnf213 T G 11: 119,437,992 I2030S Het
Rtf1 C T 2: 119,675,099 A11V unknown Het
Setdb1 T G 3: 95,338,674 T647P probably damaging Het
Shisa6 G C 11: 66,502,654 P272R possibly damaging Het
Slc25a54 G T 3: 109,116,501 G471* probably null Het
Slc30a1 A G 1: 191,909,432 T397A probably benign Het
Slc7a14 A G 3: 31,227,153 F336S possibly damaging Het
Slitrk3 C T 3: 73,050,465 V325I possibly damaging Het
Sptan1 A G 2: 29,986,929 Y361C probably damaging Het
Stard9 A G 2: 120,698,503 D1747G probably benign Het
Taf3 T C 2: 9,951,442 E638G probably damaging Het
Tbc1d8 T C 1: 39,372,533 D1074G probably benign Het
Tecrl G A 5: 83,354,907 H32Y probably benign Het
Tgm3 T A 2: 130,024,561 M133K probably benign Het
Tmem131 A G 1: 36,841,604 F195S probably damaging Het
Tmem82 T C 4: 141,614,950 I314V possibly damaging Het
Trappc10 T C 10: 78,207,493 E555G probably damaging Het
Ubn2 A T 6: 38,452,876 K176* probably null Het
Ucp1 G A 8: 83,293,902 G114R probably benign Het
Unc5c A G 3: 141,677,990 D43G probably damaging Het
Vmn2r3 C T 3: 64,261,404 V571M possibly damaging Het
Vwa3a A T 7: 120,786,465 I677L probably benign Het
Wdr48 T C 9: 119,911,081 S319P probably damaging Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 unclassified probably null
R1865:Plxnd1 UTSW 6 115969441 unclassified probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 intron probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAGAATGCCCTCCTGCTTC -3'
(R):5'- CTTGCTATGCATTGCTGTGC -3'

Sequencing Primer
(F):5'- CTCCTGCTTCGGGCCCC -3'
(R):5'- TCTCTGAGCTTCAGCAACAAGGG -3'
Posted On2019-06-26