Incidental Mutation 'R4451:Cdc27'
ID328978
Institutional Source Beutler Lab
Gene Symbol Cdc27
Ensembl Gene ENSMUSG00000020687
Gene Namecell division cycle 27
SynonymsAPC3
MMRRC Submission 041712-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4451 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location104502745-104550620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104517395 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 563 (M563K)
Ref Sequence ENSEMBL: ENSMUSP00000091452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093923] [ENSMUST00000106961] [ENSMUST00000106962]
Predicted Effect probably benign
Transcript: ENSMUST00000093923
AA Change: M563K

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000091452
Gene: ENSMUSG00000020687
AA Change: M563K

DomainStartEndE-ValueType
Pfam:Apc3 17 95 2.2e-23 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 349 362 N/A INTRINSIC
TPR 500 533 1.33e1 SMART
TPR 568 601 2.91e-6 SMART
TPR 602 635 7.06e-5 SMART
TPR 636 669 3.96e-8 SMART
TPR 670 703 7.45e-4 SMART
TPR 704 737 6.92e1 SMART
TPR 738 771 1.17e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106961
SMART Domains Protein: ENSMUSP00000102574
Gene: ENSMUSG00000020687

DomainStartEndE-ValueType
Pfam:Apc3 17 95 1.9e-23 PFAM
Pfam:TPR_2 115 148 9.2e-5 PFAM
Pfam:TPR_1 116 148 9.1e-5 PFAM
low complexity region 355 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106962
AA Change: M569K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102575
Gene: ENSMUSG00000020687
AA Change: M569K

DomainStartEndE-ValueType
Pfam:ANAPC3 17 94 7.7e-25 PFAM
TPR 115 148 4.45e-2 SMART
low complexity region 355 368 N/A INTRINSIC
TPR 506 539 1.33e1 SMART
TPR 574 607 2.91e-6 SMART
TPR 608 641 7.06e-5 SMART
TPR 642 675 3.96e-8 SMART
TPR 676 709 7.45e-4 SMART
TPR 710 743 6.92e1 SMART
TPR 744 777 1.17e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127506
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae protein Cdc27, and the gene product of Schizosaccharomyces pombe nuc 2. This protein is a component of the anaphase-promoting complex (APC), which is composed of eight protein subunits and is highly conserved in eukaryotic cells. This complex catalyzes the formation of cyclin B-ubiquitin conjugate, which is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. The protein encoded by this gene and three other members of the APC complex contain tetratricopeptide (TPR) repeats, which are important for protein-protein interactions. This protein was shown to interact with mitotic checkpoint proteins including Mad2, p55CDC and BUBR1, and it may thus be involved in controlling the timing of mitosis. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2, 22 and Y. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A C 5: 62,749,170 F169V probably benign Het
Baiap2l1 T A 5: 144,278,552 Y381F probably damaging Het
Cela3b G A 4: 137,421,044 probably benign Het
Cyp2c29 A T 19: 39,290,826 D50V probably damaging Het
Dbpht2 A T 12: 74,299,032 noncoding transcript Het
Dnah9 T A 11: 65,881,641 Q3755L probably benign Het
Dnajc2 T C 5: 21,757,794 T588A possibly damaging Het
Dync2h1 T A 9: 6,983,477 R4022S probably benign Het
Gm20481 T G 17: 34,972,133 probably benign Het
Gm7347 A G 5: 26,055,006 I182T possibly damaging Het
Gns G A 10: 121,376,696 G188S probably damaging Het
Grm5 T G 7: 88,075,132 probably null Het
Gstm4 T C 3: 108,043,975 probably null Het
Il7r T A 15: 9,512,948 K158N probably benign Het
Irs1 T C 1: 82,289,028 Y489C probably benign Het
Kcns1 C T 2: 164,168,678 E54K possibly damaging Het
Klra5 T A 6: 129,908,834 R31* probably null Het
Krt13 T C 11: 100,118,001 T409A unknown Het
Lce1e C T 3: 92,707,660 G127S unknown Het
Mfsd14a T C 3: 116,662,478 M1V probably null Het
Micall2 T C 5: 139,707,097 E891G probably damaging Het
Mpeg1 A T 19: 12,463,232 K685* probably null Het
Nbea A G 3: 55,992,332 probably null Het
Nup155 A G 15: 8,150,882 M1148V probably benign Het
Olfr1033 T C 2: 86,041,959 S215P probably damaging Het
Olfr611 A G 7: 103,517,977 S136P probably damaging Het
Otof T A 5: 30,385,164 D695V possibly damaging Het
Ptf1a G T 2: 19,446,281 A141S possibly damaging Het
Pxmp2 A T 5: 110,277,665 V168E probably damaging Het
Rab11fip1 T C 8: 27,154,477 K427E probably damaging Het
Susd2 A G 10: 75,639,398 V526A probably damaging Het
Tbx2 T C 11: 85,840,817 S647P probably damaging Het
Tg A G 15: 66,766,147 T651A probably benign Het
Trim68 T A 7: 102,684,473 M1L probably damaging Het
Ttn A C 2: 76,753,906 L20540* probably null Het
Usf3 A T 16: 44,217,888 K910N possibly damaging Het
Vmn1r14 T G 6: 57,234,228 Y220D possibly damaging Het
Vmn1r209 T A 13: 22,806,498 K7N probably benign Het
Other mutations in Cdc27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cdc27 APN 11 104521432 missense probably benign 0.01
IGL00673:Cdc27 APN 11 104528435 missense probably damaging 1.00
IGL00949:Cdc27 APN 11 104529403 missense probably damaging 1.00
IGL01529:Cdc27 APN 11 104507216 missense probably damaging 1.00
IGL01894:Cdc27 APN 11 104526921 missense probably benign 0.00
IGL02096:Cdc27 APN 11 104528568 splice site probably benign
IGL02124:Cdc27 APN 11 104522731 missense probably damaging 0.99
IGL02444:Cdc27 APN 11 104522716 splice site probably benign
IGL02589:Cdc27 APN 11 104505644 missense probably benign 0.04
IGL02851:Cdc27 APN 11 104526981 splice site probably benign
IGL02861:Cdc27 APN 11 104522831 splice site probably benign
IGL02952:Cdc27 APN 11 104517464 missense probably damaging 1.00
IGL03103:Cdc27 APN 11 104512980 missense probably benign 0.21
R0344:Cdc27 UTSW 11 104526991 splice site probably benign
R0365:Cdc27 UTSW 11 104528424 missense possibly damaging 0.68
R0366:Cdc27 UTSW 11 104505648 missense probably damaging 0.99
R0426:Cdc27 UTSW 11 104513027 splice site probably null
R0505:Cdc27 UTSW 11 104528288 missense probably benign
R0639:Cdc27 UTSW 11 104531734 missense probably damaging 1.00
R0925:Cdc27 UTSW 11 104526049 critical splice donor site probably null
R0927:Cdc27 UTSW 11 104505641 missense possibly damaging 0.88
R1414:Cdc27 UTSW 11 104521425 missense probably benign 0.26
R1765:Cdc27 UTSW 11 104534781 missense probably damaging 1.00
R1822:Cdc27 UTSW 11 104522822 missense probably benign 0.16
R2449:Cdc27 UTSW 11 104505638 missense probably benign 0.03
R3404:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3405:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3406:Cdc27 UTSW 11 104507200 missense probably damaging 1.00
R3776:Cdc27 UTSW 11 104515437 missense probably damaging 1.00
R4037:Cdc27 UTSW 11 104507207 missense probably damaging 1.00
R4385:Cdc27 UTSW 11 104534814 missense probably benign 0.10
R4452:Cdc27 UTSW 11 104517395 missense probably benign 0.05
R4530:Cdc27 UTSW 11 104528426 missense possibly damaging 0.68
R4956:Cdc27 UTSW 11 104529395 missense probably damaging 0.99
R4988:Cdc27 UTSW 11 104526124 missense possibly damaging 0.95
R5098:Cdc27 UTSW 11 104507287 missense probably damaging 1.00
R5130:Cdc27 UTSW 11 104534774 missense probably benign 0.07
R5384:Cdc27 UTSW 11 104507140 missense probably benign 0.02
R5876:Cdc27 UTSW 11 104515418 missense probably benign 0.30
R6238:Cdc27 UTSW 11 104528444 missense probably damaging 1.00
R6318:Cdc27 UTSW 11 104528694 missense probably damaging 1.00
R6354:Cdc27 UTSW 11 104534748 missense probably damaging 1.00
R6467:Cdc27 UTSW 11 104522776 missense probably damaging 1.00
R6485:Cdc27 UTSW 11 104505648 missense probably benign 0.15
R7237:Cdc27 UTSW 11 104517419 missense probably benign
R7315:Cdc27 UTSW 11 104515444 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTGATACAGGACTAGATTTGTTCTG -3'
(R):5'- TCAGTCCTGGGAAGACAGTAG -3'

Sequencing Primer
(F):5'- TCTGATGATCAAAAGCTATGCTGGG -3'
(R):5'- AGACAGTAGCGGCACTGCAC -3'
Posted On2015-07-21