Incidental Mutation 'R4462:Cdkn2d'
ID330186
Institutional Source Beutler Lab
Gene Symbol Cdkn2d
Ensembl Gene ENSMUSG00000096472
Gene Namecyclin dependent kinase inhibitor 2D
Synonymsp19, p19INK4d, INK4d, INK4d
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R4462 (G1)
Quality Score215
Status Not validated
Chromosome9
Chromosomal Location21288410-21291407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 21290889 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 21 (V21L)
Ref Sequence ENSEMBL: ENSMUSP00000150701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003397] [ENSMUST00000038671] [ENSMUST00000086374] [ENSMUST00000115433] [ENSMUST00000184326] [ENSMUST00000213407] [ENSMUST00000213762] [ENSMUST00000215619]
Predicted Effect probably benign
Transcript: ENSMUST00000003397
SMART Domains Protein: ENSMUSP00000003397
Gene: ENSMUSG00000003309

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.3e-9 PFAM
Pfam:Adap_comp_sub 157 422 7.3e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038671
SMART Domains Protein: ENSMUSP00000039688
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
low complexity region 50 60 N/A INTRINSIC
low complexity region 98 112 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
Pfam:Kri1 346 439 3.2e-27 PFAM
Pfam:Kri1_C 507 595 8.4e-37 PFAM
low complexity region 653 666 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000086374
AA Change: V21L
SMART Domains Protein: ENSMUSP00000083561
Gene: ENSMUSG00000096472
AA Change: V21L

DomainStartEndE-ValueType
ANK 41 69 1.01e2 SMART
ANK 73 102 1.73e-4 SMART
ANK 106 134 8.89e1 SMART
Blast:ANK 138 166 1e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000115433
SMART Domains Protein: ENSMUSP00000111093
Gene: ENSMUSG00000003309

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.4e-9 PFAM
Pfam:Adap_comp_sub 157 424 4.7e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183912
Predicted Effect probably benign
Transcript: ENSMUST00000184326
SMART Domains Protein: ENSMUSP00000139184
Gene: ENSMUSG00000035047

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
Pfam:Kri1 207 317 4.4e-27 PFAM
Pfam:Kri1_C 381 472 3.6e-36 PFAM
low complexity region 529 542 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184615
Predicted Effect probably benign
Transcript: ENSMUST00000213407
AA Change: V21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213762
Predicted Effect probably benign
Transcript: ENSMUST00000215619
AA Change: V21L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to form a stable complex with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. The abundance of the transcript of this gene was found to oscillate in a cell-cycle dependent manner with the lowest expression at mid G1 and a maximal expression during S phase. The negative regulation of the cell cycle involved in this protein was shown to participate in repressing neuronal proliferation, as well as spermatogenesis. Two alternatively spliced variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both female and male homozygous null mice are fertile in spite of testicular atrophy and increased male germ cell apoptosis due to delayed meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A T 6: 55,480,099 I272F possibly damaging Het
Adgrl3 C T 5: 81,688,510 A705V probably damaging Het
Arhgef12 A T 9: 42,981,982 V975E probably damaging Het
Bahd1 C T 2: 118,916,406 P169S probably damaging Het
Btnl6 A G 17: 34,508,057 S500P probably damaging Het
Ccdc39 C T 3: 33,814,668 R798Q probably damaging Het
Cdon T C 9: 35,457,580 V34A probably damaging Het
Defa17 A G 8: 21,656,537 R60G probably benign Het
Egr2 GAA GA 10: 67,539,903 probably null Het
Fuca2 T C 10: 13,503,235 V41A probably damaging Het
Ggt6 C A 11: 72,437,828 H385N possibly damaging Het
Hgsnat G A 8: 25,954,636 T428I probably damaging Het
Nefh A G 11: 4,941,015 S535P probably damaging Het
Olfr1371 T A 11: 52,213,974 N5I probably damaging Het
Olfr905 T A 9: 38,473,064 F106I probably benign Het
Pkhd1l1 T C 15: 44,581,804 F3691L probably damaging Het
Polr2a T C 11: 69,746,403 D282G probably damaging Het
Ranbp17 T C 11: 33,217,421 probably null Het
Slc13a2 T C 11: 78,404,387 T187A probably benign Het
Slco3a1 A C 7: 74,554,563 S10A probably benign Het
Snph A T 2: 151,594,115 S229T probably damaging Het
Trim38 A G 13: 23,791,452 Y458C probably null Het
Ubr4 A G 4: 139,418,502 M1537V possibly damaging Het
Other mutations in Cdkn2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02516:Cdkn2d APN 9 21289143 missense probably benign 0.04
R0238:Cdkn2d UTSW 9 21290992 start gained probably benign
R0238:Cdkn2d UTSW 9 21290992 start gained probably benign
R2064:Cdkn2d UTSW 9 21290879 missense probably damaging 1.00
R4454:Cdkn2d UTSW 9 21290889 missense probably benign
R4455:Cdkn2d UTSW 9 21290889 missense probably benign
R4456:Cdkn2d UTSW 9 21290889 missense probably benign
R4457:Cdkn2d UTSW 9 21290889 missense probably benign
R4458:Cdkn2d UTSW 9 21290889 missense probably benign
R4463:Cdkn2d UTSW 9 21290889 missense probably benign
R4735:Cdkn2d UTSW 9 21290889 missense probably benign
R4854:Cdkn2d UTSW 9 21290927 missense probably benign
R5493:Cdkn2d UTSW 9 21289007 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAGACAAGAGCTGAAAAGCCATC -3'
(R):5'- ATCATAGAGTTGGCCCTGGTG -3'

Sequencing Primer
(F):5'- GAGCTGAAAAGCCATCCCCTC -3'
(R):5'- TGGCACCGCAGTCCCTAG -3'
Posted On2015-07-21