Incidental Mutation 'R0208:Pkp4'
ID33449
Institutional Source Beutler Lab
Gene Symbol Pkp4
Ensembl Gene ENSMUSG00000026991
Gene Nameplakophilin 4
SynonymsArmrp, 9430019K17Rik, 5031422I09Rik, p0071
MMRRC Submission 038461-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0208 (G1)
Quality Score194
Status Validated
Chromosome2
Chromosomal Location59160850-59355208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59266436 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 61 (I61V)
Ref Sequence ENSEMBL: ENSMUSP00000122152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037903] [ENSMUST00000102754] [ENSMUST00000112577] [ENSMUST00000123908] [ENSMUST00000168631] [ENSMUST00000183359] [ENSMUST00000184332] [ENSMUST00000184705]
Predicted Effect probably damaging
Transcript: ENSMUST00000037903
AA Change: I61V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042249
Gene: ENSMUSG00000026991
AA Change: I61V

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
ARM 876 916 3.34e-6 SMART
ARM 964 1008 1.32e-4 SMART
low complexity region 1057 1073 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102754
AA Change: I61V

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099815
Gene: ENSMUSG00000026991
AA Change: I61V

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1083 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112577
SMART Domains Protein: ENSMUSP00000108196
Gene: ENSMUSG00000026991

DomainStartEndE-ValueType
low complexity region 126 137 N/A INTRINSIC
ARM 217 257 5.68e-9 SMART
ARM 261 302 1.61e-8 SMART
ARM 303 360 4.54e1 SMART
ARM 362 409 9.97e0 SMART
low complexity region 420 431 N/A INTRINSIC
ARM 519 559 3.34e-6 SMART
ARM 607 651 1.32e-4 SMART
low complexity region 742 759 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000123908
AA Change: I61V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122152
Gene: ENSMUSG00000026991
AA Change: I61V

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 574 614 5.68e-9 SMART
ARM 618 659 1.61e-8 SMART
ARM 660 717 4.54e1 SMART
ARM 719 766 9.97e0 SMART
low complexity region 777 788 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124725
Predicted Effect possibly damaging
Transcript: ENSMUST00000168631
AA Change: I61V

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129836
Gene: ENSMUSG00000026991
AA Change: I61V

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
low complexity region 230 246 N/A INTRINSIC
low complexity region 324 337 N/A INTRINSIC
low complexity region 467 478 N/A INTRINSIC
ARM 558 598 5.68e-9 SMART
ARM 602 643 1.61e-8 SMART
ARM 644 701 4.54e1 SMART
ARM 703 750 9.97e0 SMART
low complexity region 761 772 N/A INTRINSIC
ARM 860 900 3.34e-6 SMART
ARM 948 992 1.32e-4 SMART
low complexity region 1041 1057 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183359
AA Change: I61V

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139141
Gene: ENSMUSG00000026991
AA Change: I61V

DomainStartEndE-ValueType
coiled coil region 41 63 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183625
Predicted Effect probably benign
Transcript: ENSMUST00000184332
Predicted Effect probably benign
Transcript: ENSMUST00000184705
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo-like proteins are characterized by a series of armadillo repeats, first defined in the Drosophila 'armadillo' gene product, that are typically 42 to 45 amino acids in length. These proteins can be divided into subfamilies based on their number of repeats, their overall sequence similarity, and the dispersion of the repeats throughout their sequences. Members of the p120(ctn)/plakophilin subfamily of Armadillo-like proteins, including CTNND1, CTNND2, PKP1, PKP2, PKP4, and ARVCF. PKP4 may be a component of desmosomal plaque and other adhesion plaques and is thought to be involved in regulating junctional plaque organization and cadherin function. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
PHENOTYPE: An uncharacterized gene trap insertion does not result in an obvious phenotype during the observation period early in life, although abnormalities may still develop at older age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,661 V29A probably benign Het
Adgrb1 T C 15: 74,586,807 F313L probably benign Het
Arfgef2 C T 2: 166,867,422 R1140W probably damaging Het
Arhgef15 A T 11: 68,946,373 N797K probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Asb2 T A 12: 103,325,271 N466Y possibly damaging Het
Atp8a1 A T 5: 67,774,721 probably null Het
C130079G13Rik C T 3: 59,932,689 R61C probably damaging Het
Cacna1b A G 2: 24,607,480 S2140P probably damaging Het
Camsap2 G C 1: 136,281,000 P918R probably damaging Het
Cdk7 G T 13: 100,706,514 D202E probably benign Het
Cenpj G T 14: 56,563,970 A182E probably benign Het
Clstn3 A G 6: 124,432,169 probably benign Het
Col9a2 C T 4: 121,052,288 probably benign Het
D630045J12Rik A G 6: 38,139,450 M1745T probably damaging Het
Dnah11 A C 12: 118,043,774 N2156K probably damaging Het
Dock3 G T 9: 106,996,996 Y425* probably null Het
Eng A T 2: 32,678,993 T511S probably benign Het
Gcfc2 A T 6: 81,943,463 S410C probably null Het
Grik3 T A 4: 125,686,165 Y568N probably damaging Het
Gsr T A 8: 33,689,355 D330E possibly damaging Het
H2-M10.4 A G 17: 36,460,483 W268R probably damaging Het
Hepacam2 A T 6: 3,467,505 probably benign Het
Hrct1 C A 4: 43,727,384 T8K possibly damaging Het
Idua T A 5: 108,681,752 F447I probably damaging Het
Il2ra T C 2: 11,682,017 probably benign Het
Ipcef1 A G 10: 6,920,062 S113P probably damaging Het
Klk1b9 T A 7: 43,979,430 N119K possibly damaging Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Loxhd1 T A 18: 77,404,866 F1334L possibly damaging Het
Med1 A G 11: 98,155,689 probably benign Het
Med13 A G 11: 86,300,856 probably benign Het
Mtor C A 4: 148,464,975 H605Q probably benign Het
Muc19 A G 15: 91,893,024 noncoding transcript Het
Mybphl T C 3: 108,375,415 V207A probably damaging Het
Nptxr A T 15: 79,789,715 C366S probably null Het
Olfr1099 G T 2: 86,959,404 T18K probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr498 A G 7: 108,465,543 D73G probably damaging Het
Pcdhb18 T C 18: 37,490,187 I190T possibly damaging Het
Pde3b A G 7: 114,497,981 T428A probably benign Het
Pgbd1 A C 13: 21,434,481 L2R probably damaging Het
Pold4 T G 19: 4,232,539 Y58* probably null Het
Polr1d A C 5: 147,078,680 probably null Het
Prex2 T A 1: 11,285,144 D1556E probably damaging Het
Psmd1 T C 1: 86,133,741 V891A possibly damaging Het
Rasip1 C A 7: 45,632,575 P501T probably damaging Het
Scgb2b27 C A 7: 34,012,137 E96* probably null Het
Sec16b G T 1: 157,552,935 G359* probably null Het
Secisbp2 A G 13: 51,679,845 T674A probably benign Het
Serpinb6c G A 13: 33,897,396 S90L probably benign Het
Sgsm2 A G 11: 74,868,241 I170T probably damaging Het
Slc28a1 A T 7: 81,117,706 probably benign Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spg11 C T 2: 122,055,696 probably null Het
Spint1 T C 2: 119,248,345 probably benign Het
Spta1 A G 1: 174,192,960 H545R probably damaging Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tln1 C T 4: 43,549,151 V644M probably damaging Het
Unc79 G A 12: 103,092,027 V1016I probably benign Het
Usf3 C A 16: 44,216,906 A583E probably damaging Het
Ush2a A C 1: 188,531,761 I1612L probably damaging Het
Vmn2r6 T C 3: 64,539,912 T578A probably benign Het
Zmat4 T A 8: 23,902,067 M13K probably damaging Het
Other mutations in Pkp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pkp4 APN 2 59338755 missense probably damaging 0.99
IGL00987:Pkp4 APN 2 59308357 missense probably damaging 0.98
IGL01321:Pkp4 APN 2 59350627 splice site probably null
IGL01393:Pkp4 APN 2 59347925 missense probably damaging 1.00
IGL02058:Pkp4 APN 2 59311729 nonsense probably null
IGL02313:Pkp4 APN 2 59310254 nonsense probably null
IGL02635:Pkp4 APN 2 59305498 unclassified probably benign
IGL03017:Pkp4 APN 2 59266425 missense probably benign 0.06
IGL03051:Pkp4 APN 2 59311762 missense probably benign 0.29
degrasso UTSW 2 59318600 missense probably damaging 1.00
melted UTSW 2 59334932 critical splice donor site probably null
R0206:Pkp4 UTSW 2 59266436 missense probably damaging 0.99
R0207:Pkp4 UTSW 2 59305488 missense possibly damaging 0.89
R0325:Pkp4 UTSW 2 59318529 missense probably damaging 1.00
R0620:Pkp4 UTSW 2 59322643 missense possibly damaging 0.46
R0781:Pkp4 UTSW 2 59338765 missense probably damaging 1.00
R1110:Pkp4 UTSW 2 59338765 missense probably damaging 1.00
R1537:Pkp4 UTSW 2 59214803 missense probably damaging 1.00
R1607:Pkp4 UTSW 2 59322554 missense probably benign 0.00
R1654:Pkp4 UTSW 2 59337619 missense probably damaging 0.96
R1760:Pkp4 UTSW 2 59311841 missense probably damaging 0.97
R2051:Pkp4 UTSW 2 59334904 missense probably benign 0.37
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R2871:Pkp4 UTSW 2 59308156 missense probably benign 0.35
R3161:Pkp4 UTSW 2 59308105 missense probably damaging 1.00
R4261:Pkp4 UTSW 2 59305162 missense probably damaging 1.00
R4342:Pkp4 UTSW 2 59350608 missense probably damaging 0.98
R4731:Pkp4 UTSW 2 59334932 critical splice donor site probably null
R4799:Pkp4 UTSW 2 59342105 missense probably damaging 1.00
R4913:Pkp4 UTSW 2 59305450 missense probably damaging 1.00
R5383:Pkp4 UTSW 2 59310273 nonsense probably null
R5418:Pkp4 UTSW 2 59310162 missense probably benign 0.09
R5906:Pkp4 UTSW 2 59305076 missense possibly damaging 0.79
R5946:Pkp4 UTSW 2 59305067 missense probably benign 0.01
R6360:Pkp4 UTSW 2 59214747 missense probably benign 0.01
R6616:Pkp4 UTSW 2 59350552 nonsense probably null
R6817:Pkp4 UTSW 2 59318600 missense probably damaging 1.00
R7390:Pkp4 UTSW 2 59310140 missense possibly damaging 0.94
R7408:Pkp4 UTSW 2 59311766 missense probably damaging 1.00
R7464:Pkp4 UTSW 2 59308137 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTCATGCCCTAGAACCCAGACTGC -3'
(R):5'- TGAGTACCAGCCAACTTGCTTTACC -3'

Sequencing Primer
(F):5'- CAGACTGCACTATGCCTCG -3'
(R):5'- TGTCAGCAGCTTCTCACAAGG -3'
Posted On2013-05-09