Incidental Mutation 'R0208:Usf3'
ID33499
Institutional Source Beutler Lab
Gene Symbol Usf3
Ensembl Gene ENSMUSG00000068284
Gene Nameupstream transcription factor family member 3
SynonymsLOC207806, Gm608, LOC385650, 5530400K22Rik
MMRRC Submission 038461-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R0208 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44173246-44227465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44216906 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 583 (A583E)
Ref Sequence ENSEMBL: ENSMUSP00000128627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088356] [ENSMUST00000119746] [ENSMUST00000169582]
Predicted Effect probably benign
Transcript: ENSMUST00000088356
SMART Domains Protein: ENSMUSP00000085694
Gene: ENSMUSG00000068284

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119746
AA Change: A583E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112620
Gene: ENSMUSG00000068284
AA Change: A583E

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141015
Predicted Effect probably damaging
Transcript: ENSMUST00000169582
AA Change: A583E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128627
Gene: ENSMUSG00000068284
AA Change: A583E

DomainStartEndE-ValueType
HLH 24 75 4.26e-9 SMART
low complexity region 151 162 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 399 413 N/A INTRINSIC
low complexity region 571 587 N/A INTRINSIC
low complexity region 765 782 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 1084 1100 N/A INTRINSIC
low complexity region 1370 1382 N/A INTRINSIC
low complexity region 1419 1437 N/A INTRINSIC
low complexity region 1527 1555 N/A INTRINSIC
Meta Mutation Damage Score 0.0244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 96% (67/70)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr4 A G 9: 104,099,661 V29A probably benign Het
Adgrb1 T C 15: 74,586,807 F313L probably benign Het
Arfgef2 C T 2: 166,867,422 R1140W probably damaging Het
Arhgef15 A T 11: 68,946,373 N797K probably benign Het
Arhgef5 A G 6: 43,273,341 E342G probably damaging Het
Asb2 T A 12: 103,325,271 N466Y possibly damaging Het
Atp8a1 A T 5: 67,774,721 probably null Het
C130079G13Rik C T 3: 59,932,689 R61C probably damaging Het
Cacna1b A G 2: 24,607,480 S2140P probably damaging Het
Camsap2 G C 1: 136,281,000 P918R probably damaging Het
Cdk7 G T 13: 100,706,514 D202E probably benign Het
Cenpj G T 14: 56,563,970 A182E probably benign Het
Clstn3 A G 6: 124,432,169 probably benign Het
Col9a2 C T 4: 121,052,288 probably benign Het
D630045J12Rik A G 6: 38,139,450 M1745T probably damaging Het
Dnah11 A C 12: 118,043,774 N2156K probably damaging Het
Dock3 G T 9: 106,996,996 Y425* probably null Het
Eng A T 2: 32,678,993 T511S probably benign Het
Gcfc2 A T 6: 81,943,463 S410C probably null Het
Grik3 T A 4: 125,686,165 Y568N probably damaging Het
Gsr T A 8: 33,689,355 D330E possibly damaging Het
H2-M10.4 A G 17: 36,460,483 W268R probably damaging Het
Hepacam2 A T 6: 3,467,505 probably benign Het
Hrct1 C A 4: 43,727,384 T8K possibly damaging Het
Idua T A 5: 108,681,752 F447I probably damaging Het
Il2ra T C 2: 11,682,017 probably benign Het
Ipcef1 A G 10: 6,920,062 S113P probably damaging Het
Klk1b9 T A 7: 43,979,430 N119K possibly damaging Het
Krtap9-3 C A 11: 99,597,837 C73F probably damaging Het
Loxhd1 T A 18: 77,404,866 F1334L possibly damaging Het
Med1 A G 11: 98,155,689 probably benign Het
Med13 A G 11: 86,300,856 probably benign Het
Mtor C A 4: 148,464,975 H605Q probably benign Het
Muc19 A G 15: 91,893,024 noncoding transcript Het
Mybphl T C 3: 108,375,415 V207A probably damaging Het
Nptxr A T 15: 79,789,715 C366S probably null Het
Olfr1099 G T 2: 86,959,404 T18K probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr498 A G 7: 108,465,543 D73G probably damaging Het
Pcdhb18 T C 18: 37,490,187 I190T possibly damaging Het
Pde3b A G 7: 114,497,981 T428A probably benign Het
Pgbd1 A C 13: 21,434,481 L2R probably damaging Het
Pkp4 A G 2: 59,266,436 I61V probably damaging Het
Pold4 T G 19: 4,232,539 Y58* probably null Het
Polr1d A C 5: 147,078,680 probably null Het
Prex2 T A 1: 11,285,144 D1556E probably damaging Het
Psmd1 T C 1: 86,133,741 V891A possibly damaging Het
Rasip1 C A 7: 45,632,575 P501T probably damaging Het
Scgb2b27 C A 7: 34,012,137 E96* probably null Het
Sec16b G T 1: 157,552,935 G359* probably null Het
Secisbp2 A G 13: 51,679,845 T674A probably benign Het
Serpinb6c G A 13: 33,897,396 S90L probably benign Het
Sgsm2 A G 11: 74,868,241 I170T probably damaging Het
Slc28a1 A T 7: 81,117,706 probably benign Het
Slc35d1 T C 4: 103,208,154 T177A probably damaging Het
Spg11 C T 2: 122,055,696 probably null Het
Spint1 T C 2: 119,248,345 probably benign Het
Spta1 A G 1: 174,192,960 H545R probably damaging Het
Tada3 A T 6: 113,367,007 L227Q probably damaging Het
Tln1 C T 4: 43,549,151 V644M probably damaging Het
Unc79 G A 12: 103,092,027 V1016I probably benign Het
Ush2a A C 1: 188,531,761 I1612L probably damaging Het
Vmn2r6 T C 3: 64,539,912 T578A probably benign Het
Zmat4 T A 8: 23,902,067 M13K probably damaging Het
Other mutations in Usf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Usf3 APN 16 44212637 splice site probably null
IGL01971:Usf3 APN 16 44217446 unclassified probably null
IGL01982:Usf3 APN 16 44218817 missense possibly damaging 0.89
IGL02124:Usf3 APN 16 44219656 missense possibly damaging 0.82
IGL02309:Usf3 APN 16 44200663 missense probably benign 0.20
IGL02454:Usf3 APN 16 44217182 missense probably damaging 1.00
IGL02526:Usf3 APN 16 44220311 missense possibly damaging 0.89
IGL02671:Usf3 APN 16 44221781 missense probably damaging 1.00
IGL02800:Usf3 APN 16 44219096 missense probably benign 0.00
IGL02899:Usf3 APN 16 44221226 missense probably damaging 1.00
IGL03223:Usf3 APN 16 44216450 missense probably damaging 1.00
I1329:Usf3 UTSW 16 44220530 missense probably damaging 1.00
R0900:Usf3 UTSW 16 44215958 missense probably benign
R1160:Usf3 UTSW 16 44218547 missense probably damaging 1.00
R1417:Usf3 UTSW 16 44217449 missense probably benign 0.00
R1512:Usf3 UTSW 16 44221198 missense probably damaging 1.00
R1603:Usf3 UTSW 16 44218172 missense probably benign
R1702:Usf3 UTSW 16 44219632 nonsense probably null
R1774:Usf3 UTSW 16 44215670 missense probably damaging 1.00
R2344:Usf3 UTSW 16 44216051 missense probably benign
R2400:Usf3 UTSW 16 44215747 missense probably benign 0.04
R2484:Usf3 UTSW 16 44220682 missense probably damaging 0.99
R2570:Usf3 UTSW 16 44216381 missense probably benign 0.00
R3730:Usf3 UTSW 16 44218575 missense probably benign 0.00
R4024:Usf3 UTSW 16 44216165 missense possibly damaging 0.76
R4451:Usf3 UTSW 16 44217888 missense possibly damaging 0.76
R4883:Usf3 UTSW 16 44219579 missense probably damaging 1.00
R4895:Usf3 UTSW 16 44221096 missense possibly damaging 0.93
R4924:Usf3 UTSW 16 44217355 missense probably benign
R5020:Usf3 UTSW 16 44215526 missense probably damaging 1.00
R5034:Usf3 UTSW 16 44216399 missense probably damaging 1.00
R5053:Usf3 UTSW 16 44217187 missense probably benign 0.01
R5058:Usf3 UTSW 16 44212707 missense probably damaging 1.00
R5164:Usf3 UTSW 16 44218180 missense probably damaging 1.00
R5391:Usf3 UTSW 16 44217463 missense probably benign 0.01
R5407:Usf3 UTSW 16 44217406 missense probably benign 0.01
R5536:Usf3 UTSW 16 44217370 missense probably benign 0.16
R5805:Usf3 UTSW 16 44220746 missense possibly damaging 0.50
R5966:Usf3 UTSW 16 44220859 missense probably benign 0.14
R6024:Usf3 UTSW 16 44219840 missense probably damaging 1.00
R6122:Usf3 UTSW 16 44217307 missense probably damaging 0.99
R6180:Usf3 UTSW 16 44221105 missense probably damaging 1.00
R6362:Usf3 UTSW 16 44218577 missense probably benign 0.01
R6579:Usf3 UTSW 16 44218834 missense possibly damaging 0.54
R6874:Usf3 UTSW 16 44219740 missense probably benign 0.00
R7226:Usf3 UTSW 16 44220005 missense possibly damaging 0.54
X0057:Usf3 UTSW 16 44220784 missense probably benign 0.32
X0066:Usf3 UTSW 16 44220427 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCACAAGTTAAGTCTCAGCCTCC -3'
(R):5'- GCTGCAAAGCAAAGAGCTGTCC -3'

Sequencing Primer
(F):5'- TTAAGTCTCAGCCTCCCAAAAATATC -3'
(R):5'- CCGTTTAAAGAAATGGTTTGAGGC -3'
Posted On2013-05-09