Incidental Mutation 'R4569:Sipa1l3'
ID341999
Institutional Source Beutler Lab
Gene Symbol Sipa1l3
Ensembl Gene ENSMUSG00000030583
Gene Namesignal-induced proliferation-associated 1 like 3
Synonyms2610511M17Rik
MMRRC Submission 041793-MU
Accession Numbers

NCBI RefSeq: NM_001081028.1; MGI: 1921456

Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R4569 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29320372-29518641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 29325862 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 619 (P619Q)
Ref Sequence ENSEMBL: ENSMUSP00000138714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085809] [ENSMUST00000182484] [ENSMUST00000182780] [ENSMUST00000183096]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085809
AA Change: P1669Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082965
Gene: ENSMUSG00000030583
AA Change: P1669Q

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 816 1.7e-68 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:SPAR_C 1471 1721 1.6e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182223
Predicted Effect probably damaging
Transcript: ENSMUST00000182484
AA Change: P619Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138714
Gene: ENSMUSG00000030583
AA Change: P619Q

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 141 152 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
Pfam:DUF3401 422 671 2.7e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182780
AA Change: P14Q

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138311
Gene: ENSMUSG00000030583
AA Change: P14Q

DomainStartEndE-ValueType
low complexity region 79 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182829
Predicted Effect possibly damaging
Transcript: ENSMUST00000183096
AA Change: P1669Q

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000138171
Gene: ENSMUSG00000030583
AA Change: P1669Q

DomainStartEndE-ValueType
low complexity region 54 69 N/A INTRINSIC
low complexity region 361 380 N/A INTRINSIC
low complexity region 407 419 N/A INTRINSIC
Pfam:Rap_GAP 634 822 6.7e-64 PFAM
PDZ 969 1035 1.39e-8 SMART
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1260 1277 N/A INTRINSIC
low complexity region 1283 1294 N/A INTRINSIC
Pfam:DUF3401 1471 1721 7.2e-94 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000183330
AA Change: P741Q
Meta Mutation Damage Score 0.166 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the signal induced proliferation associated 1 family of genes, which encode GTPase-activating proteins specific for the GTP-binding protein Rap1. Rap1 has been implicated in regulation of cell adhesion, cell polarity, and organization of the cytoskeleton. Like other members of the family, the protein encoded by this gene contains RapGAP and PDZ domains. In addition, this protein contains a C-terminal leucine zipper domain. This gene is proposed to function in epithelial cell morphogenesis and establishment or maintenance of polarity. Consistently, expression of the protein in cell culture showed localization to cell-cell borders in apical regions, and downregulation of the gene in 3D Caco2 cell culture resulted in abnormal cell polarity and morphogenesis. Allelic variants of this gene have been associated with congenital cataracts in humans. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small lenses, microphthalmia, cataracts, posterior iris synechia, and abnormal lens fiber morphology. [provided by MGI curators]
Allele List at MGI

All alleles(486) : Gene trapped(486)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,625,838 T322A probably benign Het
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arfgap1 T C 2: 180,976,373 probably benign Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Ddx41 G A 13: 55,536,021 R66C possibly damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Dph1 A T 11: 75,178,895 probably benign Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gon4l T C 3: 88,910,090 probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Map4k4 G A 1: 40,000,538 R30Q probably damaging Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Mgst1 C A 6: 138,156,215 T176K probably damaging Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vmn2r71 A C 7: 85,624,194 K739Q possibly damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Xpo6 T A 7: 126,128,255 L526F probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in Sipa1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Sipa1l3 APN 7 29354133 missense probably damaging 0.97
IGL00481:Sipa1l3 APN 7 29386108 missense probably damaging 0.99
IGL01071:Sipa1l3 APN 7 29324220 missense possibly damaging 0.88
IGL01300:Sipa1l3 APN 7 29399828 nonsense probably null
IGL01361:Sipa1l3 APN 7 29348687 missense probably damaging 1.00
IGL01380:Sipa1l3 APN 7 29331372 missense possibly damaging 0.94
IGL02083:Sipa1l3 APN 7 29387261 missense probably damaging 1.00
IGL02484:Sipa1l3 APN 7 29399531 missense probably damaging 1.00
IGL02542:Sipa1l3 APN 7 29388065 missense probably damaging 1.00
IGL02645:Sipa1l3 APN 7 29328980 splice site probably null
IGL03410:Sipa1l3 APN 7 29348539 missense probably damaging 1.00
P0014:Sipa1l3 UTSW 7 29383215 missense probably damaging 1.00
R0111:Sipa1l3 UTSW 7 29348318 missense probably damaging 0.99
R0309:Sipa1l3 UTSW 7 29348350 missense probably benign 0.01
R0554:Sipa1l3 UTSW 7 29388030 missense possibly damaging 0.90
R0624:Sipa1l3 UTSW 7 29387251 missense probably damaging 1.00
R0894:Sipa1l3 UTSW 7 29387291 nonsense probably null
R1468:Sipa1l3 UTSW 7 29322260 missense possibly damaging 0.87
R1468:Sipa1l3 UTSW 7 29322260 missense possibly damaging 0.87
R1550:Sipa1l3 UTSW 7 29383203 missense probably benign 0.00
R1850:Sipa1l3 UTSW 7 29339126 missense probably damaging 0.96
R1905:Sipa1l3 UTSW 7 29339167 missense possibly damaging 0.89
R1907:Sipa1l3 UTSW 7 29339167 missense possibly damaging 0.89
R1994:Sipa1l3 UTSW 7 29399611 missense probably benign 0.39
R2228:Sipa1l3 UTSW 7 29377939 nonsense probably null
R2267:Sipa1l3 UTSW 7 29399602 missense probably damaging 1.00
R2341:Sipa1l3 UTSW 7 29377635 missense probably damaging 0.98
R3914:Sipa1l3 UTSW 7 29400085 missense probably benign 0.28
R4197:Sipa1l3 UTSW 7 29400813 missense possibly damaging 0.81
R4559:Sipa1l3 UTSW 7 29332253 missense probably damaging 1.00
R4783:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4784:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4785:Sipa1l3 UTSW 7 29377641 missense probably damaging 1.00
R4823:Sipa1l3 UTSW 7 29371002 missense probably damaging 1.00
R5057:Sipa1l3 UTSW 7 29371193 missense probably damaging 1.00
R5084:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5085:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5086:Sipa1l3 UTSW 7 29348575 missense probably damaging 1.00
R5918:Sipa1l3 UTSW 7 29397206 missense probably damaging 1.00
R5973:Sipa1l3 UTSW 7 29399524 missense probably benign 0.20
R6291:Sipa1l3 UTSW 7 29388133 missense probably damaging 1.00
R6299:Sipa1l3 UTSW 7 29366549 critical splice donor site probably null
R6828:Sipa1l3 UTSW 7 29339032 missense probably benign 0.17
R6914:Sipa1l3 UTSW 7 29386091 missense probably damaging 1.00
R6942:Sipa1l3 UTSW 7 29386091 missense probably damaging 1.00
R7102:Sipa1l3 UTSW 7 29348587 missense possibly damaging 0.74
R7225:Sipa1l3 UTSW 7 29399428 missense probably damaging 1.00
R7310:Sipa1l3 UTSW 7 29399696 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTGGAAGTCTGAGACCTGATG -3'
(R):5'- CGAGCCCTGATCAGAGAAGATC -3'

Sequencing Primer
(F):5'- AAGTCTGAGACCTGATGTCCTG -3'
(R):5'- AGATCTGTTGGGAGGGAATGG -3'
Posted On2015-09-24