Incidental Mutation 'R4569:Map4k4'
ID341964
Institutional Source Beutler Lab
Gene Symbol Map4k4
Ensembl Gene ENSMUSG00000026074
Gene Namemitogen-activated protein kinase kinase kinase kinase 4
Synonyms9430080K19Rik, Nik
MMRRC Submission 041793-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4569 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location39900913-40026310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40000538 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 30 (R30Q)
Ref Sequence ENSEMBL: ENSMUSP00000141235 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163854] [ENSMUST00000168431] [ENSMUST00000191964] [ENSMUST00000192509] [ENSMUST00000193682] [ENSMUST00000195259] [ENSMUST00000195636] [ENSMUST00000195860]
Predicted Effect probably benign
Transcript: ENSMUST00000163854
SMART Domains Protein: ENSMUSP00000126961
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168431
AA Change: R497Q
SMART Domains Protein: ENSMUSP00000129796
Gene: ENSMUSG00000026074
AA Change: R497Q

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191865
Predicted Effect probably damaging
Transcript: ENSMUST00000191964
AA Change: R30Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141235
Gene: ENSMUSG00000026074
AA Change: R30Q

DomainStartEndE-ValueType
low complexity region 4 28 N/A INTRINSIC
SCOP:d1i7qa_ 35 139 7e-3 SMART
low complexity region 195 206 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000192355
AA Change: R30Q
Predicted Effect probably benign
Transcript: ENSMUST00000192509
SMART Domains Protein: ENSMUSP00000141665
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193682
SMART Domains Protein: ENSMUSP00000141862
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 590 616 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 680 706 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
CNH 903 1201 2.76e-127 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195259
SMART Domains Protein: ENSMUSP00000142056
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 811 824 N/A INTRINSIC
low complexity region 839 849 N/A INTRINSIC
CNH 890 1188 2.76e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195356
Predicted Effect probably benign
Transcript: ENSMUST00000195636
SMART Domains Protein: ENSMUSP00000141613
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 3.4e-97 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 836 865 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
CNH 954 1252 1.4e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195860
SMART Domains Protein: ENSMUSP00000141400
Gene: ENSMUSG00000026074

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 99% (87/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos around day E9.5-10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik A G 7: 41,625,838 T322A probably benign Het
Abhd13 C T 8: 9,988,071 P223S possibly damaging Het
Adgra3 T A 5: 49,960,563 L1214F probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Ankrd13a C A 5: 114,789,312 P120Q probably damaging Het
Apbb1ip A G 2: 22,849,544 Y277C probably damaging Het
Arfgap1 T C 2: 180,976,373 probably benign Het
Arid2 T A 15: 96,392,462 V1746D probably damaging Het
C1qtnf7 T A 5: 43,609,207 N49K possibly damaging Het
Cacnb2 A T 2: 14,986,000 D587V possibly damaging Het
Ccar2 A T 14: 70,151,910 probably null Het
Cdk2ap2 T C 19: 4,097,879 F49L possibly damaging Het
Cdon A T 9: 35,476,969 I747F probably damaging Het
Cyp19a1 G A 9: 54,193,323 P27S probably benign Het
Cyp4v3 T A 8: 45,306,992 R508W probably damaging Het
Dclk1 T C 3: 55,247,410 L87P probably damaging Het
Ddx41 G A 13: 55,536,021 R66C possibly damaging Het
Dmxl1 T C 18: 49,852,360 Y225H probably damaging Het
Dnah7a G A 1: 53,411,659 P3871S probably benign Het
Dnhd1 A G 7: 105,657,166 probably null Het
Dph1 A T 11: 75,178,895 probably benign Het
Egln2 A G 7: 27,159,583 I382T probably damaging Het
Enpp3 A G 10: 24,776,882 Y726H probably damaging Het
Fbxo32 A G 15: 58,181,477 F353L probably damaging Het
Fchsd2 G A 7: 101,277,602 G657D possibly damaging Het
Fer1l4 T A 2: 156,036,639 E44V possibly damaging Het
Gjb2 C T 14: 57,100,305 V149I probably benign Het
Glipr1l1 A G 10: 112,062,412 M141V probably benign Het
Gnaq T C 19: 16,335,006 S211P probably damaging Het
Gnl1 A G 17: 35,988,250 R527G probably benign Het
Gns A G 10: 121,381,178 Q286R probably benign Het
Gon4l T C 3: 88,910,090 probably benign Het
Gpr107 T C 2: 31,207,665 probably benign Het
Gprasp1 C T X: 135,802,843 R1262C probably damaging Het
Gtf2ird1 A T 5: 134,411,003 D124E probably damaging Het
Hbp1 T A 12: 31,950,232 probably benign Het
Hrnr C T 3: 93,323,568 T371I unknown Het
Ints2 A G 11: 86,256,198 C41R probably damaging Het
Jhy A G 9: 40,911,093 I583T probably benign Het
Jph4 G T 14: 55,115,046 R77S probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klhl12 A T 1: 134,485,769 I331F probably benign Het
Mettl11b T A 1: 163,703,017 *284C probably null Het
Mgst1 C A 6: 138,156,215 T176K probably damaging Het
Negr1 C A 3: 157,208,376 probably benign Het
Nrg1 C T 8: 31,917,774 V144I probably benign Het
Olfr51 T C 11: 51,007,554 I194T possibly damaging Het
Otog A G 7: 46,310,147 D720G probably damaging Het
Pex11b A T 3: 96,644,014 probably benign Het
Phtf2 T C 5: 20,789,595 probably benign Het
Ppip5k1 C T 2: 121,343,563 R359Q possibly damaging Het
Prickle2 T C 6: 92,422,342 I185V probably benign Het
Prrc2a G A 17: 35,158,497 P562S unknown Het
Rdx A G 9: 52,068,841 I245V probably benign Het
Rem2 T C 14: 54,477,659 S98P probably damaging Het
Rhob T G 12: 8,499,373 D87A probably damaging Het
Ros1 T A 10: 52,163,994 E300D probably damaging Het
Sbf2 A G 7: 110,348,853 probably null Het
Sipa1l3 G T 7: 29,325,862 P619Q probably damaging Het
Snupn A G 9: 56,978,062 E217G probably benign Het
Ston2 T A 12: 91,639,722 *896C probably null Het
Stradb C T 1: 58,979,958 R13* probably null Het
Tbx21 G A 11: 97,114,755 A128V probably benign Het
Tep1 A T 14: 50,824,740 C2552S probably benign Het
Tgif1 A T 17: 70,844,917 V233E possibly damaging Het
Trim31 A T 17: 36,898,741 I130L probably benign Het
Trrap C T 5: 144,792,118 T614I probably benign Het
Ttn C A 2: 76,936,414 V3107F probably damaging Het
Txnrd2 T G 16: 18,456,206 D322E probably benign Het
Unc45b T A 11: 82,936,489 probably null Het
Usp43 A T 11: 67,875,352 L744* probably null Het
Usp43 C T 11: 67,898,962 C252Y probably damaging Het
Vmn2r71 A C 7: 85,624,194 K739Q possibly damaging Het
Vps16 C T 2: 130,442,204 T653M probably benign Het
Wdr83os T A 8: 85,081,866 S82R probably damaging Het
Xpo6 T A 7: 126,128,255 L526F probably damaging Het
Zfhx4 G A 3: 5,401,834 V2351I probably benign Het
Zfp558 A T 9: 18,456,503 C330S possibly damaging Het
Other mutations in Map4k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Map4k4 APN 1 40004816 missense probably damaging 0.99
IGL00417:Map4k4 APN 1 40014532 missense possibly damaging 0.92
IGL00516:Map4k4 APN 1 40014602 missense probably damaging 1.00
IGL01545:Map4k4 APN 1 40014229 splice site probably benign
IGL02092:Map4k4 APN 1 39986783 missense probably benign 0.12
IGL02092:Map4k4 APN 1 40024348 missense probably damaging 1.00
IGL02570:Map4k4 APN 1 39980579 missense probably benign 0.06
IGL02626:Map4k4 APN 1 40014097 splice site probably benign
IGL02993:Map4k4 APN 1 40014188 missense probably damaging 0.98
IGL03178:Map4k4 APN 1 39986693 missense possibly damaging 0.63
tank UTSW 1 40004864 missense possibly damaging 0.93
IGL02835:Map4k4 UTSW 1 40010600 missense probably damaging 0.99
R0496:Map4k4 UTSW 1 40006822 missense probably damaging 0.99
R0498:Map4k4 UTSW 1 39990178 missense probably benign 0.22
R0588:Map4k4 UTSW 1 40004864 missense possibly damaging 0.93
R0674:Map4k4 UTSW 1 40003815 missense probably damaging 1.00
R1205:Map4k4 UTSW 1 40003844 missense probably damaging 1.00
R1349:Map4k4 UTSW 1 40021159 missense probably damaging 1.00
R1615:Map4k4 UTSW 1 40006830 splice site probably benign
R1763:Map4k4 UTSW 1 40000757 splice site probably benign
R1800:Map4k4 UTSW 1 40023460 missense probably damaging 1.00
R1893:Map4k4 UTSW 1 40001557 missense probably benign 0.08
R2411:Map4k4 UTSW 1 40007496 missense probably damaging 0.96
R2851:Map4k4 UTSW 1 40000755 splice site probably benign
R2852:Map4k4 UTSW 1 40000755 splice site probably benign
R2987:Map4k4 UTSW 1 39986765 missense probably damaging 1.00
R3087:Map4k4 UTSW 1 40021082 critical splice acceptor site probably null
R3688:Map4k4 UTSW 1 39985171 splice site probably null
R4075:Map4k4 UTSW 1 40023462 missense probably damaging 0.96
R4304:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R4564:Map4k4 UTSW 1 39988975 missense probably damaging 1.00
R4613:Map4k4 UTSW 1 40017191 missense probably benign 0.05
R4715:Map4k4 UTSW 1 40019564 missense probably damaging 1.00
R4788:Map4k4 UTSW 1 40003916 missense probably benign 0.01
R4926:Map4k4 UTSW 1 40017225 missense probably damaging 1.00
R4943:Map4k4 UTSW 1 40019594 missense probably damaging 0.99
R5033:Map4k4 UTSW 1 40007502 missense probably damaging 0.99
R5177:Map4k4 UTSW 1 39986762 missense probably damaging 1.00
R5297:Map4k4 UTSW 1 39962217 missense probably damaging 1.00
R5844:Map4k4 UTSW 1 39999876 splice site probably benign
R5952:Map4k4 UTSW 1 39999922 unclassified probably benign
R6111:Map4k4 UTSW 1 40011662 missense probably benign 0.00
R6125:Map4k4 UTSW 1 40003965 missense possibly damaging 0.77
R6838:Map4k4 UTSW 1 39976722 missense probably damaging 1.00
R6927:Map4k4 UTSW 1 40011682 missense probably benign 0.00
R7008:Map4k4 UTSW 1 39988971 missense probably benign 0.44
R7164:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R7195:Map4k4 UTSW 1 40019669 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTCCGCAATGATGTTACAGTTAG -3'
(R):5'- CAGGGTCATAGTGAGGCTTG -3'

Sequencing Primer
(F):5'- GCAAATGCTGTCACATTTTACACAGG -3'
(R):5'- AGGCTTGGGCTCTGGAG -3'
Posted On2015-09-24