Incidental Mutation 'R4630:Eif3a'
ID349158
Institutional Source Beutler Lab
Gene Symbol Eif3a
Ensembl Gene ENSMUSG00000024991
Gene Nameeukaryotic translation initiation factor 3, subunit A
SynonymsEif3s10, A830012B05Rik, Eif3, Csma
MMRRC Submission 041895-MU
Accession Numbers

Genbank: NM_010123

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4630 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location60761116-60790693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 60769928 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 804 (I804T)
Ref Sequence ENSEMBL: ENSMUSP00000025955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025955]
Predicted Effect unknown
Transcript: ENSMUST00000025955
AA Change: I804T
SMART Domains Protein: ENSMUSP00000025955
Gene: ENSMUSG00000024991
AA Change: I804T

DomainStartEndE-ValueType
coiled coil region 82 120 N/A INTRINSIC
PINT 426 506 5.69e-18 SMART
SCOP:d1f5aa2 563 711 5e-3 SMART
coiled coil region 772 880 N/A INTRINSIC
low complexity region 919 947 N/A INTRINSIC
low complexity region 951 976 N/A INTRINSIC
internal_repeat_2 978 991 1.01e-8 PROSPERO
low complexity region 993 1007 N/A INTRINSIC
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1033 1057 N/A INTRINSIC
low complexity region 1064 1089 N/A INTRINSIC
internal_repeat_1 1090 1111 6.2e-12 PROSPERO
internal_repeat_2 1099 1112 1.01e-8 PROSPERO
internal_repeat_1 1110 1131 6.2e-12 PROSPERO
low complexity region 1146 1173 N/A INTRINSIC
low complexity region 1176 1206 N/A INTRINSIC
low complexity region 1221 1260 N/A INTRINSIC
low complexity region 1265 1297 N/A INTRINSIC
low complexity region 1301 1314 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082962
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199618
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
Allele List at MGI

All alleles(36) : Targeted, other(2) Gene trapped(34)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
3110001I22Rik T C 16: 13,677,414 S126P probably damaging Het
3110070M22Rik A T 13: 119,488,086 probably benign Het
4833423E24Rik C A 2: 85,518,646 G41* probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC024139 T G 15: 76,125,094 Q240P probably benign Het
Bckdha A T 7: 25,631,459 I44N probably damaging Het
Brpf1 T C 6: 113,309,906 Y32H probably damaging Het
Catip A G 1: 74,368,913 probably benign Het
Ccdc138 T C 10: 58,573,655 L602P probably damaging Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Comp A T 8: 70,374,382 I58F possibly damaging Het
Crygs T C 16: 22,805,518 E113G possibly damaging Het
Dnmt3b C T 2: 153,670,315 R319* probably null Het
Elf3 A T 1: 135,256,740 probably benign Het
Gm10384 A G 15: 36,871,773 noncoding transcript Het
Gm11627 T A 11: 102,578,831 probably benign Het
Gpr183 A T 14: 121,954,849 Y87N probably damaging Het
Gpr183 G C 14: 121,954,850 Y86* probably null Het
Gpr26 T C 7: 131,966,980 V18A probably damaging Het
Herc1 T A 9: 66,433,714 probably null Het
Hint2 C T 4: 43,656,396 probably benign Het
Jag1 A T 2: 137,085,979 D837E probably damaging Het
Jmjd1c C A 10: 67,157,974 S78* probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lalba T C 15: 98,482,668 M2V probably benign Het
Lama1 T A 17: 67,794,300 D1929E probably benign Het
Macf1 T C 4: 123,473,639 K878R possibly damaging Het
Mboat4 T C 8: 34,123,954 S182P probably damaging Het
Muc5b A T 7: 141,857,984 T1556S unknown Het
Myo1g T C 11: 6,519,047 Y85C probably damaging Het
Ncapd2 C A 6: 125,179,233 probably null Het
Nox3 T C 17: 3,693,982 D96G possibly damaging Het
Olfr23 T C 11: 73,940,996 L250P probably damaging Het
Olfr514 T C 7: 108,825,595 M135V probably damaging Het
Olfr805 A G 10: 129,723,481 L21P probably damaging Het
Pacs1 C T 19: 5,156,356 probably null Het
Pgm5 C A 19: 24,834,746 G141* probably null Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pld4 T A 12: 112,765,064 V217D probably damaging Het
Ppp1r3c T C 19: 36,733,515 E285G probably benign Het
Pradc1 T A 6: 85,447,293 M24L possibly damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Rtkn A T 6: 83,152,182 K540* probably null Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Setd4 A G 16: 93,591,226 L124P probably benign Het
Sh3gl2 A G 4: 85,379,409 D208G probably damaging Het
Sult4a1 T C 15: 84,105,578 T8A possibly damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Tlr4 A G 4: 66,839,240 E90G probably benign Het
Tmem123 T C 9: 7,791,392 L164P probably damaging Het
Tmem246 C G 4: 49,586,254 V305L probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Trp53bp1 G T 2: 121,207,887 A1490D probably damaging Het
Ttc16 T C 2: 32,775,377 probably benign Het
Tyw5 T A 1: 57,388,527 Q306L probably damaging Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zar1 A G 5: 72,580,906 V51A probably benign Het
Zbtb38 T G 9: 96,688,851 N60T probably damaging Het
Zfp354a T C 11: 51,070,218 S417P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp518a C T 19: 40,912,979 Q451* probably null Het
Zfp64 T C 2: 168,926,543 N383S possibly damaging Het
Zfp687 A T 3: 95,012,488 probably null Het
Other mutations in Eif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Eif3a APN 19 60769890 missense unknown
IGL00981:Eif3a APN 19 60766611 missense unknown
IGL01650:Eif3a APN 19 60773996 missense probably damaging 1.00
IGL01926:Eif3a APN 19 60769961 missense unknown
IGL02100:Eif3a APN 19 60767004 splice site probably benign
IGL02316:Eif3a APN 19 60771638 splice site probably benign
IGL02444:Eif3a APN 19 60773607 missense possibly damaging 0.89
IGL02552:Eif3a APN 19 60763226 unclassified probably benign
IGL02797:Eif3a APN 19 60772726 missense probably damaging 1.00
IGL03108:Eif3a APN 19 60782309 missense possibly damaging 0.85
FR4304:Eif3a UTSW 19 60775290 critical splice donor site probably benign
FR4548:Eif3a UTSW 19 60775291 critical splice donor site probably benign
FR4737:Eif3a UTSW 19 60775289 critical splice donor site probably benign
FR4976:Eif3a UTSW 19 60775291 critical splice donor site probably benign
G5538:Eif3a UTSW 19 60781902 missense probably damaging 0.97
R0054:Eif3a UTSW 19 60766826 missense unknown
R0054:Eif3a UTSW 19 60766826 missense unknown
R1483:Eif3a UTSW 19 60768726 missense unknown
R1636:Eif3a UTSW 19 60781905 missense possibly damaging 0.93
R1748:Eif3a UTSW 19 60766798 missense unknown
R1857:Eif3a UTSW 19 60782197 missense probably damaging 1.00
R1858:Eif3a UTSW 19 60782197 missense probably damaging 1.00
R1993:Eif3a UTSW 19 60781516 missense probably benign 0.19
R2034:Eif3a UTSW 19 60762130 unclassified probably benign
R2099:Eif3a UTSW 19 60764113 unclassified probably benign
R2140:Eif3a UTSW 19 60775394 splice site probably benign
R2434:Eif3a UTSW 19 60764050 unclassified probably benign
R2940:Eif3a UTSW 19 60773677 missense probably benign 0.22
R4630:Eif3a UTSW 19 60777986 missense probably benign 0.41
R4926:Eif3a UTSW 19 60763218 unclassified probably benign
R5366:Eif3a UTSW 19 60779533 missense probably benign 0.12
R6003:Eif3a UTSW 19 60766881 missense unknown
R6082:Eif3a UTSW 19 60772130 missense possibly damaging 0.82
R6256:Eif3a UTSW 19 60771026 missense possibly damaging 0.72
X0028:Eif3a UTSW 19 60781902 missense probably damaging 0.97
X0066:Eif3a UTSW 19 60762293 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGATAGAGGAAGCAGCACC -3'
(R):5'- GCTCTCAGTGATACTAGTCCAGTG -3'

Sequencing Primer
(F):5'- TAGAGGAAGCAGCACCAACATATTC -3'
(R):5'- CTCAGTGATACTAGTCCAGTGTGTAG -3'
Posted On2015-10-08