Incidental Mutation 'R4630:Zfp687'
ID349098
Institutional Source Beutler Lab
Gene Symbol Zfp687
Ensembl Gene ENSMUSG00000019338
Gene Namezinc finger protein 687
Synonyms4931408L03Rik
MMRRC Submission 041895-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.774) question?
Stock #R4630 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location95006590-95015448 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 95012488 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019482] [ENSMUST00000128438] [ENSMUST00000128438] [ENSMUST00000132195] [ENSMUST00000132195] [ENSMUST00000137799] [ENSMUST00000149747] [ENSMUST00000149747]
Predicted Effect probably null
Transcript: ENSMUST00000019482
SMART Domains Protein: ENSMUSP00000019482
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
ZnF_C2H2 764 787 2.67e-1 SMART
ZnF_C2H2 792 815 4.4e-2 SMART
ZnF_C2H2 827 849 7.67e-2 SMART
ZnF_C2H2 858 881 2.36e-2 SMART
low complexity region 884 898 N/A INTRINSIC
low complexity region 914 938 N/A INTRINSIC
ZnF_C2H2 964 987 4.05e-1 SMART
ZnF_C2H2 994 1017 1.38e-3 SMART
ZnF_C2H2 1024 1050 4.65e-1 SMART
low complexity region 1057 1075 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
ZnF_C2H2 1135 1158 4.98e-1 SMART
ZnF_C2H2 1200 1222 1.82e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128160
Predicted Effect probably null
Transcript: ENSMUST00000128438
SMART Domains Protein: ENSMUSP00000119354
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000128438
SMART Domains Protein: ENSMUSP00000119354
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132195
SMART Domains Protein: ENSMUSP00000117308
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000132195
SMART Domains Protein: ENSMUSP00000117308
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137799
SMART Domains Protein: ENSMUSP00000123335
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 170 186 N/A INTRINSIC
low complexity region 296 306 N/A INTRINSIC
low complexity region 312 325 N/A INTRINSIC
ZnF_C2H2 533 553 4.74e1 SMART
ZnF_C2H2 561 585 1.43e1 SMART
low complexity region 615 634 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
ZnF_C2H2 673 693 7.37e1 SMART
ZnF_C2H2 705 727 1.99e0 SMART
ZnF_C2H2 733 757 3.38e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147022
Predicted Effect probably null
Transcript: ENSMUST00000149747
SMART Domains Protein: ENSMUSP00000116053
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000149747
SMART Domains Protein: ENSMUSP00000116053
Gene: ENSMUSG00000019338

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151207
Meta Mutation Damage Score 0.6252 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes C2H2 zinc finger protein. The encoded protein may play a role in bone differentiation and development. Mutations in this gene are the cause of Paget disease of bone-6. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,068,092 S393P probably benign Het
3110001I22Rik T C 16: 13,677,414 S126P probably damaging Het
3110070M22Rik A T 13: 119,488,086 probably benign Het
4833423E24Rik C A 2: 85,518,646 G41* probably null Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
BC024139 T G 15: 76,125,094 Q240P probably benign Het
Bckdha A T 7: 25,631,459 I44N probably damaging Het
Brpf1 T C 6: 113,309,906 Y32H probably damaging Het
Catip A G 1: 74,368,913 probably benign Het
Ccdc138 T C 10: 58,573,655 L602P probably damaging Het
Cilp A T 9: 65,279,880 T1086S probably benign Het
Comp A T 8: 70,374,382 I58F possibly damaging Het
Crygs T C 16: 22,805,518 E113G possibly damaging Het
Dnmt3b C T 2: 153,670,315 R319* probably null Het
Eif3a A G 19: 60,769,928 I804T unknown Het
Eif3a A T 19: 60,777,986 H301Q probably benign Het
Elf3 A T 1: 135,256,740 probably benign Het
Gm10384 A G 15: 36,871,773 noncoding transcript Het
Gm11627 T A 11: 102,578,831 probably benign Het
Gpr183 A T 14: 121,954,849 Y87N probably damaging Het
Gpr183 G C 14: 121,954,850 Y86* probably null Het
Gpr26 T C 7: 131,966,980 V18A probably damaging Het
Herc1 T A 9: 66,433,714 probably null Het
Hint2 C T 4: 43,656,396 probably benign Het
Jag1 A T 2: 137,085,979 D837E probably damaging Het
Jmjd1c C A 10: 67,157,974 S78* probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Lalba T C 15: 98,482,668 M2V probably benign Het
Lama1 T A 17: 67,794,300 D1929E probably benign Het
Macf1 T C 4: 123,473,639 K878R possibly damaging Het
Mboat4 T C 8: 34,123,954 S182P probably damaging Het
Muc5b A T 7: 141,857,984 T1556S unknown Het
Myo1g T C 11: 6,519,047 Y85C probably damaging Het
Ncapd2 C A 6: 125,179,233 probably null Het
Nox3 T C 17: 3,693,982 D96G possibly damaging Het
Olfr23 T C 11: 73,940,996 L250P probably damaging Het
Olfr514 T C 7: 108,825,595 M135V probably damaging Het
Olfr805 A G 10: 129,723,481 L21P probably damaging Het
Pacs1 C T 19: 5,156,356 probably null Het
Pgm5 C A 19: 24,834,746 G141* probably null Het
Pik3r4 A G 9: 105,654,899 M557V probably benign Het
Pld4 T A 12: 112,765,064 V217D probably damaging Het
Ppp1r3c T C 19: 36,733,515 E285G probably benign Het
Pradc1 T A 6: 85,447,293 M24L possibly damaging Het
Prepl T C 17: 85,083,231 T100A probably benign Het
Rmi2 C T 16: 10,886,209 T138I probably benign Het
Rtkn A T 6: 83,152,182 K540* probably null Het
Sag C A 1: 87,834,618 T335K probably damaging Het
Setd4 A G 16: 93,591,226 L124P probably benign Het
Sh3gl2 A G 4: 85,379,409 D208G probably damaging Het
Sult4a1 T C 15: 84,105,578 T8A possibly damaging Het
Tert A G 13: 73,648,991 D1116G probably damaging Het
Tlr4 A G 4: 66,839,240 E90G probably benign Het
Tmem123 T C 9: 7,791,392 L164P probably damaging Het
Tmem246 C G 4: 49,586,254 V305L probably benign Het
Top2b T G 14: 16,409,189 I777M probably damaging Het
Trak1 G A 9: 121,454,425 R419Q probably benign Het
Trp53bp1 G T 2: 121,207,887 A1490D probably damaging Het
Ttc16 T C 2: 32,775,377 probably benign Het
Tyw5 T A 1: 57,388,527 Q306L probably damaging Het
Ube2j2 T A 4: 155,955,258 I14N probably damaging Het
Vmn2r103 T C 17: 19,793,696 I250T probably benign Het
Zar1 A G 5: 72,580,906 V51A probably benign Het
Zbtb38 T G 9: 96,688,851 N60T probably damaging Het
Zfp354a T C 11: 51,070,218 S417P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp518a C T 19: 40,912,979 Q451* probably null Het
Zfp64 T C 2: 168,926,543 N383S possibly damaging Het
Other mutations in Zfp687
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Zfp687 APN 3 95012416 missense probably damaging 1.00
IGL00510:Zfp687 APN 3 95008447 missense probably damaging 1.00
IGL00824:Zfp687 APN 3 95009185 missense probably damaging 1.00
IGL01861:Zfp687 APN 3 95011860 missense probably damaging 1.00
IGL02167:Zfp687 APN 3 95010530 missense probably benign
IGL02169:Zfp687 APN 3 95011432 missense probably damaging 1.00
IGL02260:Zfp687 APN 3 95011264 missense possibly damaging 0.92
IGL02539:Zfp687 APN 3 95011062 missense probably damaging 0.99
IGL02710:Zfp687 APN 3 95008773 missense probably benign 0.01
IGL02891:Zfp687 APN 3 95011946 missense probably damaging 0.97
IGL03186:Zfp687 APN 3 95011094 missense probably benign
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0006:Zfp687 UTSW 3 95011456 missense probably damaging 0.99
R0243:Zfp687 UTSW 3 95011553 missense probably damaging 0.99
R0556:Zfp687 UTSW 3 95010408 missense probably damaging 1.00
R1111:Zfp687 UTSW 3 95009512 missense probably damaging 1.00
R1170:Zfp687 UTSW 3 95008473 missense probably damaging 1.00
R1236:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R1482:Zfp687 UTSW 3 95007533 missense probably damaging 1.00
R1711:Zfp687 UTSW 3 95011889 missense probably benign 0.00
R2255:Zfp687 UTSW 3 95010437 missense probably damaging 1.00
R3763:Zfp687 UTSW 3 95012080 missense probably damaging 1.00
R3848:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R3850:Zfp687 UTSW 3 95007914 missense probably damaging 1.00
R4424:Zfp687 UTSW 3 95009128 missense probably damaging 1.00
R4989:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5119:Zfp687 UTSW 3 95011676 missense probably benign 0.28
R5134:Zfp687 UTSW 3 95010386 missense probably damaging 1.00
R5249:Zfp687 UTSW 3 95009466 missense probably damaging 1.00
R5408:Zfp687 UTSW 3 95009275 unclassified probably benign
R5454:Zfp687 UTSW 3 95009146 missense probably damaging 1.00
R5732:Zfp687 UTSW 3 95011217 missense possibly damaging 0.50
R5883:Zfp687 UTSW 3 95012044 missense probably benign 0.01
R6342:Zfp687 UTSW 3 95011877 missense probably benign 0.01
R6395:Zfp687 UTSW 3 95007738 missense possibly damaging 0.48
R6463:Zfp687 UTSW 3 95010784 missense probably damaging 1.00
R6575:Zfp687 UTSW 3 95008389 missense probably damaging 1.00
R6972:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R6973:Zfp687 UTSW 3 95009377 missense possibly damaging 0.65
R7087:Zfp687 UTSW 3 95010213 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GACTCTCAGGGTCATTCTCAGC -3'
(R):5'- AACCTGATTTTAGGGTTTGGCAC -3'

Sequencing Primer
(F):5'- AGAATCTCCTCCTACACTGGG -3'
(R):5'- GGGTTTGGCACACTGAATACTTCAAG -3'
Posted On2015-10-08