Incidental Mutation 'R4633:Krtap4-9'
ID349369
Institutional Source Beutler Lab
Gene Symbol Krtap4-9
Ensembl Gene ENSMUSG00000078262
Gene Namekeratin associated protein 4-9
SynonymsOTTMUSG00000002198
MMRRC Submission 041898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4633 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99785200-99786258 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 99785554 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105059] [ENSMUST00000107439]
Predicted Effect unknown
Transcript: ENSMUST00000105059
AA Change: R100S
SMART Domains Protein: ENSMUSP00000100680
Gene: ENSMUSG00000078262
AA Change: R100S

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 1 47 1.2e-8 PFAM
Pfam:Keratin_B2_2 14 58 4.4e-13 PFAM
Pfam:Keratin_B2_2 54 102 3e-10 PFAM
Pfam:Keratin_B2_2 87 132 8.4e-12 PFAM
Pfam:Keratin_B2_2 98 147 3.4e-9 PFAM
Pfam:Keratin_B2_2 138 182 3.1e-12 PFAM
Pfam:Keratin_B2_2 178 222 4.8e-12 PFAM
Pfam:Keratin_B2_2 203 244 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107439
SMART Domains Protein: ENSMUSP00000103063
Gene: ENSMUSG00000089724

DomainStartEndE-ValueType
Pfam:Keratin_B2_2 14 58 1.8e-13 PFAM
Pfam:Keratin_B2_2 54 98 6.7e-15 PFAM
Pfam:Keratin_B2_2 94 138 9.5e-15 PFAM
Pfam:Keratin_B2_2 138 182 1.5e-12 PFAM
Pfam:Keratin_B2_2 168 209 8.2e-9 PFAM
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 95% (73/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T A 17: 24,387,529 L786Q probably null Het
Abcb6 A T 1: 75,177,782 probably benign Het
Alg10b T C 15: 90,228,294 V447A probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
B4galt7 A G 13: 55,608,750 H203R probably damaging Het
Ccdc130 T C 8: 84,260,395 T158A probably benign Het
Cd44 T G 2: 102,853,047 D214A possibly damaging Het
Ces1c T C 8: 93,118,386 D275G probably benign Het
Cnot11 G T 1: 39,536,218 W127L probably benign Het
Csmd1 A G 8: 16,002,620 I2168T probably damaging Het
Cyp3a59 T C 5: 146,094,438 F137S probably damaging Het
Dst T A 1: 34,170,434 L1234Q probably damaging Het
Erbb2 T A 11: 98,432,988 I676N possibly damaging Het
Erlin1 G A 19: 44,040,765 R243C probably damaging Het
Fanci T C 7: 79,427,242 L576P probably damaging Het
Fzd1 A T 5: 4,755,865 Y572* probably null Het
Glg1 C T 8: 111,177,644 probably null Het
Gm884 A T 11: 103,619,131 probably benign Het
Gpr139 A T 7: 119,144,405 I319N probably damaging Het
Hectd4 C A 5: 121,349,216 H3425N probably benign Het
Itga10 A G 3: 96,647,704 D118G possibly damaging Het
Klra13-ps T G 6: 130,291,173 noncoding transcript Het
Krt1 C T 15: 101,846,187 G543S unknown Het
Krt5 T A 15: 101,711,607 D225V probably damaging Het
Lama1 C A 17: 67,798,584 A2029E probably damaging Het
Lrp2 T A 2: 69,461,417 T3473S probably benign Het
Lrriq1 G A 10: 103,200,563 R910* probably null Het
Map1b C T 13: 99,434,942 V424M probably damaging Het
Mkl2 T C 16: 13,379,873 I85T possibly damaging Het
Mylk2 T C 2: 152,917,415 S369P probably benign Het
Myom3 T G 4: 135,775,699 F362L probably benign Het
Nomo1 A G 7: 46,050,260 probably benign Het
Olfr1362 A G 13: 21,611,228 V247A probably damaging Het
Olfr168 C T 16: 19,530,284 G212D possibly damaging Het
Olfr59 T G 11: 74,289,294 M216R probably benign Het
Olfr982 T A 9: 40,074,334 V13E probably damaging Het
Parp4 C T 14: 56,647,591 L1376F unknown Het
Phykpl C A 11: 51,593,608 A208E probably damaging Het
Pla2g15 T C 8: 106,160,255 F126S probably damaging Het
Polq T G 16: 37,048,542 M479R probably damaging Het
Prpf4b A G 13: 34,900,442 T938A probably damaging Het
Psma1 A G 7: 114,271,134 M63T probably damaging Het
Rbpms2 T C 9: 65,651,636 S174P probably benign Het
Rcc1 G T 4: 132,335,769 S162R probably damaging Het
Rev3l T G 10: 39,846,186 L2520R probably damaging Het
Rhobtb1 T A 10: 69,249,613 probably null Het
Rps19 G T 7: 24,889,170 probably benign Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Het
Selenof C T 3: 144,596,861 R116* probably null Het
Slc16a11 T C 11: 70,216,379 probably null Het
Stk3 A G 15: 34,958,928 V296A probably damaging Het
Taar8b C A 10: 24,092,252 E15* probably null Het
Tas2r102 T A 6: 132,762,679 N183K possibly damaging Het
Tcrg-C4 G T 13: 19,352,287 V172F probably benign Het
Tet2 T A 3: 133,485,549 E1041D probably benign Het
Tm9sf1 A G 14: 55,641,203 V244A probably damaging Het
Trim24 T A 6: 37,956,436 I650K probably damaging Het
Trim59 G T 3: 69,037,414 Q198K probably benign Het
Ttc28 C T 5: 111,224,001 T772I probably damaging Het
Tvp23a C T 16: 10,427,045 V146M probably benign Het
Usp17la A T 7: 104,860,221 D11V possibly damaging Het
Usp48 A G 4: 137,634,900 K32R probably damaging Het
Uspl1 A G 5: 149,214,392 K801E probably damaging Het
Utp20 T C 10: 88,752,952 I2452V probably benign Het
Vps18 T C 2: 119,293,276 L228P probably damaging Het
Zfp410 A T 12: 84,325,736 D112V probably damaging Het
Zfp872 G T 9: 22,197,194 probably null Het
Zswim8 A G 14: 20,718,823 E1110G probably damaging Het
Other mutations in Krtap4-9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01949:Krtap4-9 APN 11 99785565 unclassified probably benign
IGL02697:Krtap4-9 APN 11 99785748 missense unknown
IGL03176:Krtap4-9 APN 11 99785280 unclassified probably benign
R0988:Krtap4-9 UTSW 11 99785536 nonsense probably null
R1773:Krtap4-9 UTSW 11 99785570 unclassified probably benign
R1838:Krtap4-9 UTSW 11 99785396 unclassified probably benign
R2566:Krtap4-9 UTSW 11 99785666 unclassified probably benign
R2888:Krtap4-9 UTSW 11 99785419 nonsense probably null
R3757:Krtap4-9 UTSW 11 99785618 unclassified probably benign
R5930:Krtap4-9 UTSW 11 99785636 unclassified probably benign
R6092:Krtap4-9 UTSW 11 99785655 unclassified probably benign
R6501:Krtap4-9 UTSW 11 99785429 unclassified probably benign
R6934:Krtap4-9 UTSW 11 99785882 nonsense probably null
R7131:Krtap4-9 UTSW 11 99785457 missense unknown
Predicted Primers PCR Primer
(F):5'- CATGGTCAGCTCCTGTTGTG -3'
(R):5'- CTAGAACTACCACAGCAGGG -3'

Sequencing Primer
(F):5'- TGCTGTAGGACCACCTGCTG -3'
(R):5'- TGGACACACAGCAGCTG -3'
Posted On2015-10-08