Incidental Mutation 'R4648:Dhx16'
ID350532
Institutional Source Beutler Lab
Gene Symbol Dhx16
Ensembl Gene ENSMUSG00000024422
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 16
SynonymsDdx16, DBP2, 2410006N22Rik
MMRRC Submission 041909-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R4648 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35879819-35892670 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 35885635 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 565 (A565G)
Ref Sequence ENSEMBL: ENSMUSP00000133888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025292] [ENSMUST00000174366]
Predicted Effect probably benign
Transcript: ENSMUST00000025292
AA Change: A565G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025292
Gene: ENSMUSG00000024422
AA Change: A565G

DomainStartEndE-ValueType
Blast:DEXDc 55 310 6e-57 BLAST
DEXDc 400 585 7.26e-33 SMART
HELICc 636 733 1.7e-15 SMART
HA2 794 885 2.24e-31 SMART
Pfam:OB_NTP_bind 901 1018 3.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173596
Predicted Effect probably benign
Transcript: ENSMUST00000173967
SMART Domains Protein: ENSMUSP00000133818
Gene: ENSMUSG00000024422

DomainStartEndE-ValueType
Blast:DEXDc 2 83 5e-35 BLAST
PDB:3I4U|A 4 83 6e-14 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174330
Predicted Effect probably benign
Transcript: ENSMUST00000174366
AA Change: A565G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000133888
Gene: ENSMUSG00000024422
AA Change: A565G

DomainStartEndE-ValueType
Blast:DEXDc 55 310 9e-58 BLAST
DEXDc 400 585 7.26e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174449
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a functional homolog of fission yeast Prp8 protein involved in cell cycle progression. This gene is mapped to the MHC region on chromosome 6p21.3, a region where many malignant, genetic and autoimmune disease genes are linked. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 Y232F probably benign Het
2310079G19Rik T C 16: 88,627,367 S79G probably benign Het
4930568D16Rik T A 2: 35,354,446 Y298F probably damaging Het
Alpk2 A G 18: 65,349,882 F352L probably damaging Het
Angpt1 T A 15: 42,676,184 Y93F probably benign Het
Ankrd33b T C 15: 31,325,024 *129W probably null Het
Atp5j T C 16: 84,828,455 M87V probably benign Het
Atp8b3 A G 10: 80,525,623 S822P possibly damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bbs2 A T 8: 94,080,879 V429E probably damaging Het
Bccip C T 7: 133,714,899 L83F probably damaging Het
Brd9 G A 13: 73,940,776 V198I probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C77080 G T 4: 129,221,940 T977K probably benign Het
Calhm1 A G 19: 47,143,801 L125P probably damaging Het
Ccdc110 A T 8: 45,942,668 Q532L possibly damaging Het
Cdh19 G A 1: 110,925,177 L343F probably benign Het
Cep350 A G 1: 155,902,598 S1653P possibly damaging Het
Cmtm4 A G 8: 104,356,320 I135T possibly damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Crp A G 1: 172,698,137 M1V probably null Het
Csmd1 G A 8: 15,998,788 Q2305* probably null Het
Cyp2c38 T A 19: 39,460,688 I74F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcaf1 A T 9: 106,865,677 probably benign Het
Dock7 C A 4: 98,969,644 E1448* probably null Het
Dpf2 C T 19: 5,907,081 R38H probably damaging Het
E030030I06Rik T A 10: 22,148,845 R56S unknown Het
Etnk1 A G 6: 143,195,274 Y248C probably damaging Het
Ext1 A G 15: 53,089,987 S494P possibly damaging Het
Gk2 T C 5: 97,455,720 S420G probably benign Het
Gm26596 T C 10: 112,929,159 probably benign Het
Gm5414 G T 15: 101,628,108 N27K possibly damaging Het
Gskip A G 12: 105,698,729 D9G probably benign Het
H2-K2 T A 17: 33,976,015 noncoding transcript Het
Hk1 T G 10: 62,304,779 S105R probably benign Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Idnk A G 13: 58,162,869 D67G probably benign Het
Igfbp5 G T 1: 72,864,063 H118N probably benign Het
Irf4 A T 13: 30,763,597 Y427F probably benign Het
Khdc3 A G 9: 73,102,586 E26G possibly damaging Het
Kif7 T C 7: 79,709,191 D512G probably damaging Het
Lamb3 T A 1: 193,331,357 I513N probably damaging Het
Lipo1 A G 19: 33,783,460 L174P probably damaging Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Map3k21 A G 8: 125,942,111 D812G probably benign Het
Mast2 G T 4: 116,314,839 Y637* probably null Het
Matn2 T C 15: 34,428,533 I681T probably damaging Het
Med18 A T 4: 132,462,963 V37D possibly damaging Het
Mip T A 10: 128,227,053 H122Q probably benign Het
Mmp13 A T 9: 7,274,233 D180V probably damaging Het
Mpg C A 11: 32,230,034 C187* probably null Het
Mtmr14 A G 6: 113,260,606 E256G probably benign Het
Myo7b C T 18: 31,967,125 probably null Het
Nmt1 T A 11: 103,063,917 V425D probably damaging Het
Nynrin T A 14: 55,872,894 Y1819* probably null Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1330 A G 4: 118,893,950 N289S possibly damaging Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Otof T C 5: 30,383,570 E875G possibly damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Phc1 T C 6: 122,321,913 I699V possibly damaging Het
Prkdc T G 16: 15,816,774 D3594E probably benign Het
Pstpip1 A T 9: 56,125,218 D246V probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Ror2 A T 13: 53,285,500 C9* probably null Het
Setd1b C T 5: 123,148,112 A407V unknown Het
Slc26a4 T G 12: 31,540,526 D376A possibly damaging Het
Smarcad1 A G 6: 65,067,089 E215G probably benign Het
Spag16 G A 1: 69,827,035 R11Q probably null Het
Sult1d1 T A 5: 87,566,095 Q30L probably benign Het
Tbc1d5 A G 17: 50,736,223 C746R probably benign Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trem1 G A 17: 48,244,562 V84I probably benign Het
Tspan5 T C 3: 138,898,315 F154L probably damaging Het
Usp45 A G 4: 21,825,044 R647G probably benign Het
Usp50 T A 2: 126,778,033 I120F probably damaging Het
Vil1 T C 1: 74,432,298 M746T probably benign Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Dhx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Dhx16 APN 17 35887934 missense probably benign 0.02
IGL01533:Dhx16 APN 17 35882047 missense probably damaging 1.00
IGL01743:Dhx16 APN 17 35888108 missense probably damaging 1.00
IGL01946:Dhx16 APN 17 35885504 missense probably benign 0.01
IGL02170:Dhx16 APN 17 35889469 missense probably damaging 1.00
IGL02327:Dhx16 APN 17 35883825 missense probably benign 0.00
IGL02334:Dhx16 APN 17 35884057 missense probably damaging 1.00
IGL02417:Dhx16 APN 17 35892537 missense probably damaging 1.00
R0403:Dhx16 UTSW 17 35883050 critical splice donor site probably null
R0410:Dhx16 UTSW 17 35890967 missense probably damaging 1.00
R0544:Dhx16 UTSW 17 35881659 missense probably benign 0.35
R0835:Dhx16 UTSW 17 35881689 missense probably damaging 1.00
R0845:Dhx16 UTSW 17 35883302 missense probably damaging 1.00
R1642:Dhx16 UTSW 17 35891065 missense probably damaging 1.00
R1833:Dhx16 UTSW 17 35885619 missense probably benign 0.36
R1905:Dhx16 UTSW 17 35888355 missense probably benign
R2233:Dhx16 UTSW 17 35887886 missense probably damaging 1.00
R2234:Dhx16 UTSW 17 35887886 missense probably damaging 1.00
R4647:Dhx16 UTSW 17 35885635 missense probably benign 0.10
R4665:Dhx16 UTSW 17 35879943 missense probably damaging 1.00
R4674:Dhx16 UTSW 17 35885939 missense probably damaging 1.00
R4862:Dhx16 UTSW 17 35883262 missense probably benign 0.34
R5089:Dhx16 UTSW 17 35884089 missense probably damaging 1.00
R5122:Dhx16 UTSW 17 35883310 missense probably damaging 1.00
R5665:Dhx16 UTSW 17 35891086 nonsense probably null
R5748:Dhx16 UTSW 17 35883314 missense probably damaging 1.00
R5763:Dhx16 UTSW 17 35881688 missense possibly damaging 0.87
R5956:Dhx16 UTSW 17 35882870 missense probably damaging 0.96
R6001:Dhx16 UTSW 17 35883874 missense probably damaging 1.00
R6216:Dhx16 UTSW 17 35882972 missense possibly damaging 0.49
R6420:Dhx16 UTSW 17 35883014 missense possibly damaging 0.92
R6467:Dhx16 UTSW 17 35886184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGCTAAGTCCACTGTCC -3'
(R):5'- TATAGGGTCACAGAAGGGCC -3'

Sequencing Primer
(F):5'- GCTAAGTCCACTGTCCCTTCTC -3'
(R):5'- TCACAGAAGGGCCACTTGCTC -3'
Posted On2015-10-08