Incidental Mutation 'R4648:Alpk2'
ID350537
Institutional Source Beutler Lab
Gene Symbol Alpk2
Ensembl Gene ENSMUSG00000032845
Gene Namealpha-kinase 2
SynonymsHak
MMRRC Submission 041909-MU
Accession Numbers

Genbank: NM_001037294

Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R4648 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location65265529-65393888 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65349882 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 352 (F352L)
Ref Sequence ENSEMBL: ENSMUSP00000048752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035548] [ENSMUST00000141250]
Predicted Effect probably damaging
Transcript: ENSMUST00000035548
AA Change: F352L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048752
Gene: ENSMUSG00000032845
AA Change: F352L

DomainStartEndE-ValueType
IGc2 24 94 9.34e-4 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1337 1353 N/A INTRINSIC
IG 1766 1849 2.27e-2 SMART
Alpha_kinase 1879 2098 3.72e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141250
SMART Domains Protein: ENSMUSP00000114658
Gene: ENSMUSG00000032845

DomainStartEndE-ValueType
low complexity region 255 267 N/A INTRINSIC
low complexity region 558 570 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
IG 1299 1382 2.27e-2 SMART
Alpha_kinase 1412 1603 2.45e-56 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 102,860,909 N132K possibly damaging Het
2010315B03Rik T A 9: 124,293,598 Y232F probably benign Het
2310079G19Rik T C 16: 88,627,367 S79G probably benign Het
4930568D16Rik T A 2: 35,354,446 Y298F probably damaging Het
Angpt1 T A 15: 42,676,184 Y93F probably benign Het
Ankrd33b T C 15: 31,325,024 *129W probably null Het
Atp5j T C 16: 84,828,455 M87V probably benign Het
Atp8b3 A G 10: 80,525,623 S822P possibly damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Bbs2 A T 8: 94,080,879 V429E probably damaging Het
Bccip C T 7: 133,714,899 L83F probably damaging Het
Brd9 G A 13: 73,940,776 V198I probably benign Het
C1galt1c1 A T X: 38,631,472 S216T probably benign Het
C77080 G T 4: 129,221,940 T977K probably benign Het
Calhm1 A G 19: 47,143,801 L125P probably damaging Het
Ccdc110 A T 8: 45,942,668 Q532L possibly damaging Het
Cdh19 G A 1: 110,925,177 L343F probably benign Het
Cep350 A G 1: 155,902,598 S1653P possibly damaging Het
Cmtm4 A G 8: 104,356,320 I135T possibly damaging Het
Cmya5 A G 13: 93,093,828 L1584P possibly damaging Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Crp A G 1: 172,698,137 M1V probably null Het
Csmd1 G A 8: 15,998,788 Q2305* probably null Het
Cyp2c38 T A 19: 39,460,688 I74F probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcaf1 A T 9: 106,865,677 probably benign Het
Dhx16 C G 17: 35,885,635 A565G probably benign Het
Dock7 C A 4: 98,969,644 E1448* probably null Het
Dpf2 C T 19: 5,907,081 R38H probably damaging Het
E030030I06Rik T A 10: 22,148,845 R56S unknown Het
Etnk1 A G 6: 143,195,274 Y248C probably damaging Het
Ext1 A G 15: 53,089,987 S494P possibly damaging Het
Gk2 T C 5: 97,455,720 S420G probably benign Het
Gm26596 T C 10: 112,929,159 probably benign Het
Gm5414 G T 15: 101,628,108 N27K possibly damaging Het
Gskip A G 12: 105,698,729 D9G probably benign Het
H2-K2 T A 17: 33,976,015 noncoding transcript Het
Hk1 T G 10: 62,304,779 S105R probably benign Het
Hmg20b T A 10: 81,348,582 Q129L probably damaging Het
Idnk A G 13: 58,162,869 D67G probably benign Het
Igfbp5 G T 1: 72,864,063 H118N probably benign Het
Irf4 A T 13: 30,763,597 Y427F probably benign Het
Khdc3 A G 9: 73,102,586 E26G possibly damaging Het
Kif7 T C 7: 79,709,191 D512G probably damaging Het
Lamb3 T A 1: 193,331,357 I513N probably damaging Het
Lipo1 A G 19: 33,783,460 L174P probably damaging Het
Lnx1 C T 5: 74,610,796 V350I probably benign Het
Map3k21 A G 8: 125,942,111 D812G probably benign Het
Mast2 G T 4: 116,314,839 Y637* probably null Het
Matn2 T C 15: 34,428,533 I681T probably damaging Het
Med18 A T 4: 132,462,963 V37D possibly damaging Het
Mip T A 10: 128,227,053 H122Q probably benign Het
Mmp13 A T 9: 7,274,233 D180V probably damaging Het
Mpg C A 11: 32,230,034 C187* probably null Het
Mtmr14 A G 6: 113,260,606 E256G probably benign Het
Myo7b C T 18: 31,967,125 probably null Het
Nmt1 T A 11: 103,063,917 V425D probably damaging Het
Nynrin T A 14: 55,872,894 Y1819* probably null Het
Olfr1212 T A 2: 88,959,212 F249I probably damaging Het
Olfr1330 A G 4: 118,893,950 N289S possibly damaging Het
Olfr152 T C 2: 87,783,221 V227A possibly damaging Het
Otof T C 5: 30,383,570 E875G possibly damaging Het
Paqr3 T A 5: 97,108,210 R102* probably null Het
Phc1 T C 6: 122,321,913 I699V possibly damaging Het
Prkdc T G 16: 15,816,774 D3594E probably benign Het
Pstpip1 A T 9: 56,125,218 D246V probably damaging Het
Rbm46 A T 3: 82,864,458 D283E probably benign Het
Ror2 A T 13: 53,285,500 C9* probably null Het
Setd1b C T 5: 123,148,112 A407V unknown Het
Slc26a4 T G 12: 31,540,526 D376A possibly damaging Het
Smarcad1 A G 6: 65,067,089 E215G probably benign Het
Spag16 G A 1: 69,827,035 R11Q probably null Het
Sult1d1 T A 5: 87,566,095 Q30L probably benign Het
Tbc1d5 A G 17: 50,736,223 C746R probably benign Het
Tdh A G 14: 63,493,756 L323P possibly damaging Het
Tet2 A T 3: 133,488,082 M197K probably benign Het
Tnn T C 1: 160,146,042 M252V probably benign Het
Trdn G T 10: 33,195,981 E215* probably null Het
Trem1 G A 17: 48,244,562 V84I probably benign Het
Tspan5 T C 3: 138,898,315 F154L probably damaging Het
Usp45 A G 4: 21,825,044 R647G probably benign Het
Usp50 T A 2: 126,778,033 I120F probably damaging Het
Vil1 T C 1: 74,432,298 M746T probably benign Het
Washc4 T A 10: 83,574,543 M665K possibly damaging Het
Zfp750 T C 11: 121,511,880 T681A probably benign Het
Other mutations in Alpk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Alpk2 APN 18 65305823 missense probably benign 0.27
IGL00478:Alpk2 APN 18 65307226 nonsense probably null
IGL00898:Alpk2 APN 18 65350573 missense probably benign 0.29
IGL00978:Alpk2 APN 18 65291534 splice site probably benign
IGL01093:Alpk2 APN 18 65349329 missense probably damaging 0.98
IGL01094:Alpk2 APN 18 65306602 missense probably damaging 0.96
IGL01109:Alpk2 APN 18 65307140 missense probably benign 0.09
IGL01370:Alpk2 APN 18 65350591 missense possibly damaging 0.56
IGL01393:Alpk2 APN 18 65307708 missense possibly damaging 0.88
IGL01629:Alpk2 APN 18 65300042 missense probably damaging 1.00
IGL01872:Alpk2 APN 18 65304753 missense probably benign 0.01
IGL01983:Alpk2 APN 18 65350682 missense probably damaging 1.00
IGL02294:Alpk2 APN 18 65306075 missense possibly damaging 0.45
IGL02333:Alpk2 APN 18 65349480 missense probably damaging 0.99
IGL02493:Alpk2 APN 18 65350331 missense probably benign 0.02
IGL02551:Alpk2 APN 18 65372751 missense probably damaging 1.00
IGL02864:Alpk2 APN 18 65307599 missense probably benign 0.12
IGL02901:Alpk2 APN 18 65306411 missense probably benign
IGL02954:Alpk2 APN 18 65306136 missense probably benign
IGL03257:Alpk2 APN 18 65349874 missense probably damaging 0.99
IGL03389:Alpk2 APN 18 65304866 missense possibly damaging 0.92
3-1:Alpk2 UTSW 18 65304888 missense probably damaging 0.99
PIT4131001:Alpk2 UTSW 18 65306379 missense possibly damaging 0.84
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0098:Alpk2 UTSW 18 65349911 missense probably damaging 1.00
R0414:Alpk2 UTSW 18 65306159 missense probably benign 0.04
R0546:Alpk2 UTSW 18 65306717 missense probably benign 0.05
R0628:Alpk2 UTSW 18 65307296 missense possibly damaging 0.94
R0658:Alpk2 UTSW 18 65349487 missense probably damaging 1.00
R0731:Alpk2 UTSW 18 65305390 missense probably damaging 0.98
R0919:Alpk2 UTSW 18 65307473 missense probably benign
R1069:Alpk2 UTSW 18 65305014 missense probably benign 0.25
R1186:Alpk2 UTSW 18 65294341 critical splice acceptor site probably null
R1508:Alpk2 UTSW 18 65349305 missense probably damaging 1.00
R1535:Alpk2 UTSW 18 65350204 missense probably benign
R1558:Alpk2 UTSW 18 65350230 missense probably benign
R1600:Alpk2 UTSW 18 65378037 missense probably damaging 0.96
R1664:Alpk2 UTSW 18 65349873 missense probably damaging 0.96
R1672:Alpk2 UTSW 18 65280959 missense probably damaging 1.00
R1829:Alpk2 UTSW 18 65294094 missense possibly damaging 0.75
R2110:Alpk2 UTSW 18 65307080 missense possibly damaging 0.94
R2111:Alpk2 UTSW 18 65349774 missense probably benign
R2113:Alpk2 UTSW 18 65305683 missense probably benign 0.31
R2126:Alpk2 UTSW 18 65350368 nonsense probably null
R2198:Alpk2 UTSW 18 65350184 missense probably benign 0.42
R2227:Alpk2 UTSW 18 65378076 missense probably damaging 1.00
R2245:Alpk2 UTSW 18 65305163 missense probably benign 0.02
R2282:Alpk2 UTSW 18 65307626 missense probably benign
R2421:Alpk2 UTSW 18 65306616 missense probably benign 0.00
R2512:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R3105:Alpk2 UTSW 18 65350210 missense possibly damaging 0.57
R3700:Alpk2 UTSW 18 65305151 missense probably damaging 0.99
R4205:Alpk2 UTSW 18 65305211 missense possibly damaging 0.76
R4239:Alpk2 UTSW 18 65300141 missense probably damaging 1.00
R4353:Alpk2 UTSW 18 65291452 missense possibly damaging 0.73
R4572:Alpk2 UTSW 18 65281004 missense probably damaging 1.00
R4584:Alpk2 UTSW 18 65306964 missense probably damaging 0.99
R4591:Alpk2 UTSW 18 65305823 missense probably benign 0.27
R4595:Alpk2 UTSW 18 65289748 missense probably damaging 1.00
R4815:Alpk2 UTSW 18 65349955 missense probably damaging 1.00
R4828:Alpk2 UTSW 18 65349113 missense probably benign
R4910:Alpk2 UTSW 18 65266286 nonsense probably null
R5042:Alpk2 UTSW 18 65350508 nonsense probably null
R5295:Alpk2 UTSW 18 65305038 missense probably damaging 0.98
R5375:Alpk2 UTSW 18 65372738 missense probably damaging 1.00
R5475:Alpk2 UTSW 18 65307012 missense probably benign 0.16
R5480:Alpk2 UTSW 18 65349908 missense probably damaging 1.00
R5486:Alpk2 UTSW 18 65294354 splice site probably null
R5503:Alpk2 UTSW 18 65306241 missense probably benign 0.00
R5595:Alpk2 UTSW 18 65266248 missense probably damaging 1.00
R5648:Alpk2 UTSW 18 65349917 missense probably damaging 0.96
R5714:Alpk2 UTSW 18 65305461 missense possibly damaging 0.55
R5862:Alpk2 UTSW 18 65307289 missense probably damaging 1.00
R5894:Alpk2 UTSW 18 65281072 missense probably damaging 0.99
R5898:Alpk2 UTSW 18 65307623 missense probably damaging 0.99
R5936:Alpk2 UTSW 18 65350520 missense probably damaging 0.96
R6142:Alpk2 UTSW 18 65305385 missense possibly damaging 0.94
R6291:Alpk2 UTSW 18 65305901 missense possibly damaging 0.93
R6339:Alpk2 UTSW 18 65349806 missense probably benign 0.00
R6407:Alpk2 UTSW 18 65289738 missense probably benign 0.22
R6487:Alpk2 UTSW 18 65266183 missense possibly damaging 0.62
R6667:Alpk2 UTSW 18 65307740 missense probably damaging 1.00
R6786:Alpk2 UTSW 18 65306634 missense probably benign
R6833:Alpk2 UTSW 18 65306409 missense probably benign 0.08
R6984:Alpk2 UTSW 18 65305678 missense possibly damaging 0.95
X0023:Alpk2 UTSW 18 65291400 missense probably damaging 1.00
X0027:Alpk2 UTSW 18 65307471 missense possibly damaging 0.89
X0063:Alpk2 UTSW 18 65307363 missense probably benign
X0064:Alpk2 UTSW 18 65349684 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GGGTAAGAGTCATTTCTGAATGCAG -3'
(R):5'- TCCAGCGAAGACTCTGACAG -3'

Sequencing Primer
(F):5'- CATTTCTGAATGCAGGGGTAAC -3'
(R):5'- CAGTGACTATGAACTTTGCCCAGAG -3'
Posted On2015-10-08