Incidental Mutation 'R3981:Olfr1062'
ID351148
Institutional Source Beutler Lab
Gene Symbol Olfr1062
Ensembl Gene ENSMUSG00000090059
Gene Nameolfactory receptor 1062
SynonymsGA_x6K02T2Q125-47892992-47892045, MOR185-1
MMRRC Submission 040943-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3981 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86420399-86426749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86422842 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 278 (Y278F)
Ref Sequence ENSEMBL: ENSMUSP00000149742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105213] [ENSMUST00000217481]
Predicted Effect probably damaging
Transcript: ENSMUST00000105213
AA Change: Y278F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100848
Gene: ENSMUSG00000090059
AA Change: Y278F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.8e-46 PFAM
Pfam:7tm_1 41 290 2.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216166
Predicted Effect probably damaging
Transcript: ENSMUST00000217481
AA Change: Y278F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,971,534 T289I probably damaging Het
Abca13 T G 11: 9,532,407 C4313G probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bhlhe22 G T 3: 18,054,894 R36L probably damaging Het
Cacnb2 A G 2: 14,604,503 E18G probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cep295 G T 9: 15,317,067 probably benign Het
Cep89 A G 7: 35,438,383 R731G probably damaging Het
Chrnb3 C T 8: 27,394,006 T257M probably damaging Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Clca4b T C 3: 144,926,036 K236R probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cry1 A T 10: 85,146,592 Y297N probably damaging Het
Defb38 A G 8: 19,026,467 probably null Het
Dlgap1 A G 17: 70,516,785 K255R probably damaging Het
Erich6 T C 3: 58,636,704 E154G probably benign Het
Esf1 G A 2: 140,158,556 P437S probably benign Het
Fkbp7 A C 2: 76,663,257 N197K probably damaging Het
Fsip2 T A 2: 82,958,662 D342E probably benign Het
Gbx1 T C 5: 24,526,215 D201G probably benign Het
Gm15056 T A 8: 20,900,941 K25N possibly damaging Het
Grb7 T G 11: 98,454,565 probably benign Het
H2-M3 C T 17: 37,271,130 A159V probably damaging Het
Hcar1 T C 5: 123,878,620 N336S probably benign Het
Ift122 T C 6: 115,913,921 V807A probably benign Het
Maml2 T C 9: 13,621,068 V526A possibly damaging Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Mras T C 9: 99,411,416 D57G probably damaging Het
Muc5ac T C 7: 141,813,775 C2274R possibly damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Ros1 G A 10: 52,120,878 H1233Y possibly damaging Het
Samd8 A G 14: 21,780,180 R225G probably null Het
Slc7a11 C A 3: 50,427,774 V175L probably benign Het
Spata31d1c A G 13: 65,035,111 T156A possibly damaging Het
Stxbp5 T C 10: 9,789,316 probably benign Het
Tec T A 5: 72,823,599 probably benign Het
Tex37 T C 6: 70,913,299 N170D possibly damaging Het
Vps16 T C 2: 130,442,594 W728R possibly damaging Het
Xirp1 T C 9: 120,017,744 E691G probably damaging Het
Zfp605 T C 5: 110,127,738 S241P probably damaging Het
Zfp839 G A 12: 110,866,331 G561D probably damaging Het
Other mutations in Olfr1062
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02040:Olfr1062 APN 2 86422992 missense probably damaging 0.98
IGL02638:Olfr1062 APN 2 86423677 unclassified probably null
IGL02863:Olfr1062 APN 2 86423113 missense probably benign 0.44
R0211:Olfr1062 UTSW 2 86423107 missense probably damaging 0.96
R0211:Olfr1062 UTSW 2 86423107 missense probably damaging 0.96
R1486:Olfr1062 UTSW 2 86423481 missense probably damaging 0.99
R2327:Olfr1062 UTSW 2 86422821 nonsense probably null
R3695:Olfr1062 UTSW 2 86423643 missense probably damaging 0.96
R4156:Olfr1062 UTSW 2 86423200 missense possibly damaging 0.67
R4860:Olfr1062 UTSW 2 86422957 missense probably damaging 1.00
R4860:Olfr1062 UTSW 2 86422957 missense probably damaging 1.00
R5024:Olfr1062 UTSW 2 86423461 missense possibly damaging 0.77
R5351:Olfr1062 UTSW 2 86423266 missense probably damaging 1.00
R5566:Olfr1062 UTSW 2 86423377 nonsense probably null
R5777:Olfr1062 UTSW 2 86423325 missense probably benign 0.00
R6628:Olfr1062 UTSW 2 86423017 missense probably benign 0.02
R7039:Olfr1062 UTSW 2 86422833 missense possibly damaging 0.48
R7159:Olfr1062 UTSW 2 86423612 synonymous probably null
R7236:Olfr1062 UTSW 2 86423189 nonsense probably null
R7251:Olfr1062 UTSW 2 86423596 missense probably benign 0.45
X0065:Olfr1062 UTSW 2 86423122 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GAAGTTTTAGGTCCTGACATTTACC -3'
(R):5'- CACTCACCTTCCAGAAACTGTTG -3'

Sequencing Primer
(F):5'- CAAAAATATCTTTGAAGAACAGTGCC -3'
(R):5'- CAGCGACAAACTTGTTTTTCTCTATG -3'
Posted On2015-10-08