Incidental Mutation 'R3981:Map3k20'
ID351145
Institutional Source Beutler Lab
Gene Symbol Map3k20
Ensembl Gene ENSMUSG00000004085
Gene Namemitogen-activated protein kinase kinase kinase 20
SynonymsMLTKalpha, Zak, MLTKbeta, B230120H23Rik
MMRRC Submission 040943-MU
Accession Numbers

Genbank: NM_023057, NM_178084; MGI: 2443258

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3981 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location72285637-72442610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72438227 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 526 (T526I)
Ref Sequence ENSEMBL: ENSMUSP00000088334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090824]
Predicted Effect probably damaging
Transcript: ENSMUST00000090824
AA Change: T526I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088334
Gene: ENSMUSG00000004085
AA Change: T526I

DomainStartEndE-ValueType
Pfam:Pkinase 16 259 6.3e-56 PFAM
Pfam:Pkinase_Tyr 16 260 9.9e-64 PFAM
coiled coil region 277 328 N/A INTRINSIC
SAM 336 410 5.59e-7 SMART
low complexity region 643 668 N/A INTRINSIC
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MAPKKK family of signal transduction molecules and encodes a protein with an N-terminal kinase catalytic domain, followed by a leucine zipper motif and a sterile-alpha motif (SAM). This magnesium-binding protein forms homodimers and is located in the cytoplasm. The protein mediates gamma radiation signaling leading to cell cycle arrest and activity of this protein plays a role in cell cycle checkpoint regulation in cells. The protein also has pro-apoptotic activity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality at E9.5 with growth retardation. Mice homozygous for an allele lacking the SAM domain exhibit low penetrant unilateral complex hindlimb duplication phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,971,534 T289I probably damaging Het
Abca13 T G 11: 9,532,407 C4313G probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bhlhe22 G T 3: 18,054,894 R36L probably damaging Het
Cacnb2 A G 2: 14,604,503 E18G probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cep295 G T 9: 15,317,067 probably benign Het
Cep89 A G 7: 35,438,383 R731G probably damaging Het
Chrnb3 C T 8: 27,394,006 T257M probably damaging Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Clca4b T C 3: 144,926,036 K236R probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cry1 A T 10: 85,146,592 Y297N probably damaging Het
Defb38 A G 8: 19,026,467 probably null Het
Dlgap1 A G 17: 70,516,785 K255R probably damaging Het
Erich6 T C 3: 58,636,704 E154G probably benign Het
Esf1 G A 2: 140,158,556 P437S probably benign Het
Fkbp7 A C 2: 76,663,257 N197K probably damaging Het
Fsip2 T A 2: 82,958,662 D342E probably benign Het
Gbx1 T C 5: 24,526,215 D201G probably benign Het
Gm15056 T A 8: 20,900,941 K25N possibly damaging Het
Grb7 T G 11: 98,454,565 probably benign Het
H2-M3 C T 17: 37,271,130 A159V probably damaging Het
Hcar1 T C 5: 123,878,620 N336S probably benign Het
Ift122 T C 6: 115,913,921 V807A probably benign Het
Maml2 T C 9: 13,621,068 V526A possibly damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Mras T C 9: 99,411,416 D57G probably damaging Het
Muc5ac T C 7: 141,813,775 C2274R possibly damaging Het
Olfr1062 T A 2: 86,422,842 Y278F probably damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Ros1 G A 10: 52,120,878 H1233Y possibly damaging Het
Samd8 A G 14: 21,780,180 R225G probably null Het
Slc7a11 C A 3: 50,427,774 V175L probably benign Het
Spata31d1c A G 13: 65,035,111 T156A possibly damaging Het
Stxbp5 T C 10: 9,789,316 probably benign Het
Tec T A 5: 72,823,599 probably benign Het
Tex37 T C 6: 70,913,299 N170D possibly damaging Het
Vps16 T C 2: 130,442,594 W728R possibly damaging Het
Xirp1 T C 9: 120,017,744 E691G probably damaging Het
Zfp605 T C 5: 110,127,738 S241P probably damaging Het
Zfp839 G A 12: 110,866,331 G561D probably damaging Het
Other mutations in Map3k20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Map3k20 APN 2 72412170 missense probably damaging 1.00
IGL00333:Map3k20 APN 2 72371976 missense probably damaging 0.99
IGL00505:Map3k20 APN 2 72389483 missense probably damaging 1.00
IGL01472:Map3k20 APN 2 72355553 splice site probably benign
IGL01982:Map3k20 APN 2 72298333 nonsense probably null
IGL02556:Map3k20 APN 2 72371895 missense probably damaging 0.98
IGL02831:Map3k20 APN 2 72371727 missense probably damaging 1.00
3-1:Map3k20 UTSW 2 72412125 missense probably damaging 1.00
R0765:Map3k20 UTSW 2 72371925 missense probably damaging 1.00
R1160:Map3k20 UTSW 2 72441520 missense probably benign 0.01
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1195:Map3k20 UTSW 2 72438218 missense probably damaging 1.00
R1406:Map3k20 UTSW 2 72389494 missense probably damaging 0.99
R1406:Map3k20 UTSW 2 72389494 missense probably damaging 0.99
R1509:Map3k20 UTSW 2 72364624 splice site probably benign
R1634:Map3k20 UTSW 2 72410177 nonsense probably null
R1723:Map3k20 UTSW 2 72389492 missense probably damaging 1.00
R1986:Map3k20 UTSW 2 72441294 nonsense probably null
R2014:Map3k20 UTSW 2 72438260 missense probably benign 0.00
R2086:Map3k20 UTSW 2 72398385 missense probably benign 0.01
R2311:Map3k20 UTSW 2 72368440 missense probably damaging 1.00
R2655:Map3k20 UTSW 2 72433420 missense probably damaging 1.00
R3150:Map3k20 UTSW 2 72371992 missense probably damaging 1.00
R3781:Map3k20 UTSW 2 72402355 intron probably benign
R3950:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3951:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3952:Map3k20 UTSW 2 72438300 missense probably damaging 0.99
R3982:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R3983:Map3k20 UTSW 2 72438227 missense probably damaging 0.99
R4011:Map3k20 UTSW 2 72384124 splice site probably benign
R4180:Map3k20 UTSW 2 72441571 missense probably damaging 0.97
R4790:Map3k20 UTSW 2 72441704 missense probably benign
R4895:Map3k20 UTSW 2 72402356 intron probably benign
R4943:Map3k20 UTSW 2 72371918 missense possibly damaging 0.90
R4983:Map3k20 UTSW 2 72402067 missense probably benign 0.00
R5023:Map3k20 UTSW 2 72402345 intron probably benign
R5157:Map3k20 UTSW 2 72438214 missense probably benign 0.00
R5703:Map3k20 UTSW 2 72402170 missense probably benign 0.00
R6134:Map3k20 UTSW 2 72410159 missense probably damaging 0.99
R6322:Map3k20 UTSW 2 72433470 missense possibly damaging 0.95
R6418:Map3k20 UTSW 2 72402113 missense probably benign 0.15
R6449:Map3k20 UTSW 2 72398414 missense probably damaging 1.00
R6495:Map3k20 UTSW 2 72368419 missense probably damaging 1.00
R6508:Map3k20 UTSW 2 72441909 missense probably benign 0.08
R7016:Map3k20 UTSW 2 72378635 missense probably damaging 1.00
R7173:Map3k20 UTSW 2 72441414 missense probably benign 0.06
R7319:Map3k20 UTSW 2 72364718 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGAATCCATTATGAGAAAGGGG -3'
(R):5'- TGTCTGAGTTAGGCATCTGAGC -3'

Sequencing Primer
(F):5'- TCCATTATGAGAAAGGGGGTTGG -3'
(R):5'- TCCTCTGCAATGGGAATCTCATAAC -3'
Posted On2015-10-08