Incidental Mutation 'R3981:Mmd2'
ID351164
Institutional Source Beutler Lab
Gene Symbol Mmd2
Ensembl Gene ENSMUSG00000039533
Gene Namemonocyte to macrophage differentiation-associated 2
Synonyms
MMRRC Submission 040943-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3981 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location142562358-142608800 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 142564799 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 228 (Y228C)
Ref Sequence ENSEMBL: ENSMUSP00000039357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037048]
Predicted Effect probably damaging
Transcript: ENSMUST00000037048
AA Change: Y228C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039357
Gene: ENSMUSG00000039533
AA Change: Y228C

DomainStartEndE-ValueType
Pfam:HlyIII 33 228 5.2e-21 PFAM
Meta Mutation Damage Score 0.29 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PAQR (progestin and adipoQ receptor) family. Members of this family are evolutionarily conserved with significant sequence identity to bacterial hemolysin-like proteins and are defined by a set of seven transmembrane domains. The protein encoded by this gene localizes to the Golgi apparatus to modulate Ras signaling. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik C T 4: 42,971,534 T289I probably damaging Het
Abca13 T G 11: 9,532,407 C4313G probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Bckdk C A 7: 127,905,418 R105S probably damaging Het
Bhlhe22 G T 3: 18,054,894 R36L probably damaging Het
Cacnb2 A G 2: 14,604,503 E18G probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cep295 G T 9: 15,317,067 probably benign Het
Cep89 A G 7: 35,438,383 R731G probably damaging Het
Chrnb3 C T 8: 27,394,006 T257M probably damaging Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Clca4b T C 3: 144,926,036 K236R probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cry1 A T 10: 85,146,592 Y297N probably damaging Het
Defb38 A G 8: 19,026,467 probably null Het
Dlgap1 A G 17: 70,516,785 K255R probably damaging Het
Erich6 T C 3: 58,636,704 E154G probably benign Het
Esf1 G A 2: 140,158,556 P437S probably benign Het
Fkbp7 A C 2: 76,663,257 N197K probably damaging Het
Fsip2 T A 2: 82,958,662 D342E probably benign Het
Gbx1 T C 5: 24,526,215 D201G probably benign Het
Gm15056 T A 8: 20,900,941 K25N possibly damaging Het
Grb7 T G 11: 98,454,565 probably benign Het
H2-M3 C T 17: 37,271,130 A159V probably damaging Het
Hcar1 T C 5: 123,878,620 N336S probably benign Het
Ift122 T C 6: 115,913,921 V807A probably benign Het
Maml2 T C 9: 13,621,068 V526A possibly damaging Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Mras T C 9: 99,411,416 D57G probably damaging Het
Muc5ac T C 7: 141,813,775 C2274R possibly damaging Het
Olfr1062 T A 2: 86,422,842 Y278F probably damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Prpmp5 G A 6: 132,312,694 P56S unknown Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Ros1 G A 10: 52,120,878 H1233Y possibly damaging Het
Samd8 A G 14: 21,780,180 R225G probably null Het
Slc7a11 C A 3: 50,427,774 V175L probably benign Het
Spata31d1c A G 13: 65,035,111 T156A possibly damaging Het
Stxbp5 T C 10: 9,789,316 probably benign Het
Tec T A 5: 72,823,599 probably benign Het
Tex37 T C 6: 70,913,299 N170D possibly damaging Het
Vps16 T C 2: 130,442,594 W728R possibly damaging Het
Xirp1 T C 9: 120,017,744 E691G probably damaging Het
Zfp605 T C 5: 110,127,738 S241P probably damaging Het
Zfp839 G A 12: 110,866,331 G561D probably damaging Het
Other mutations in Mmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Mmd2 APN 5 142575229 missense probably damaging 1.00
IGL02221:Mmd2 APN 5 142569457 splice site probably benign
IGL02432:Mmd2 APN 5 142575339 missense probably damaging 1.00
IGL02964:Mmd2 APN 5 142569477 missense probably damaging 1.00
IGL03333:Mmd2 APN 5 142567938 splice site probably benign
R0615:Mmd2 UTSW 5 142564913 missense probably benign 0.04
R1717:Mmd2 UTSW 5 142575350 splice site probably benign
R2034:Mmd2 UTSW 5 142575184 critical splice donor site probably null
R3982:Mmd2 UTSW 5 142564799 missense probably damaging 1.00
R4501:Mmd2 UTSW 5 142575210 missense probably benign 0.00
R6103:Mmd2 UTSW 5 142567863 critical splice donor site probably null
R6521:Mmd2 UTSW 5 142574830 missense probably damaging 1.00
R7222:Mmd2 UTSW 5 142567927 missense probably benign 0.04
R7244:Mmd2 UTSW 5 142564832 missense probably damaging 1.00
X0024:Mmd2 UTSW 5 142575244 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCTTGTTGGGGATTCAAAAGG -3'
(R):5'- GAATGACTGCTCTCCCTCTGAC -3'

Sequencing Primer
(F):5'- CTGAAAGGTTCCTTAGACCCATG -3'
(R):5'- GACTGCTCTCCCTCTGACTTGAC -3'
Posted On2015-10-08