Incidental Mutation 'R4701:Lingo1'
ID356046
Institutional Source Beutler Lab
Gene Symbol Lingo1
Ensembl Gene ENSMUSG00000049556
Gene Nameleucine rich repeat and Ig domain containing 1
SynonymsLINGO-1, LERN1, Lrrn6a, UNQ201, 4930471K13Rik
MMRRC Submission 041949-MU
Accession Numbers

Genbank: NM_181074; MGI: 1915522

Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R4701 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location56618475-56796468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56620258 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 349 (F349S)
Ref Sequence ENSEMBL: ENSMUSP00000148179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053568] [ENSMUST00000114247] [ENSMUST00000114256] [ENSMUST00000210032]
Predicted Effect probably damaging
Transcript: ENSMUST00000053568
AA Change: F349S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059050
Gene: ENSMUSG00000049556
AA Change: F349S

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
LRRNT 35 69 1.6e-3 SMART
LRR 88 111 6.22e0 SMART
LRR_TYP 112 135 5.81e-2 SMART
LRR 136 159 6.57e-1 SMART
LRR 160 183 3.02e0 SMART
LRR 184 207 1.51e0 SMART
LRR 208 231 1.81e2 SMART
LRR 280 303 8.26e1 SMART
LRR 304 327 9.24e1 SMART
LRR 328 351 1.43e-1 SMART
LRRCT 363 416 4.15e-2 SMART
IGc2 431 498 1.58e-10 SMART
transmembrane domain 554 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114247
AA Change: F349S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109885
Gene: ENSMUSG00000049556
AA Change: F349S

DomainStartEndE-ValueType
low complexity region 21 32 N/A INTRINSIC
LRRNT 35 69 1.6e-3 SMART
LRR 88 111 6.22e0 SMART
LRR_TYP 112 135 5.81e-2 SMART
LRR 136 159 6.57e-1 SMART
LRR 160 183 3.02e0 SMART
LRR 184 207 1.51e0 SMART
LRR 208 231 1.81e2 SMART
LRR 280 303 8.26e1 SMART
LRR 304 327 9.24e1 SMART
LRR 328 351 1.43e-1 SMART
LRRCT 363 416 4.15e-2 SMART
IGc2 431 498 1.58e-10 SMART
transmembrane domain 554 576 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114256
AA Change: F355S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109894
Gene: ENSMUSG00000049556
AA Change: F355S

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
LRRNT 41 75 1.6e-3 SMART
LRR 94 117 6.22e0 SMART
LRR_TYP 118 141 5.81e-2 SMART
LRR 142 165 6.57e-1 SMART
LRR 166 189 3.02e0 SMART
LRR 190 213 1.51e0 SMART
LRR 214 237 1.81e2 SMART
LRR 286 309 8.26e1 SMART
LRR 310 333 9.24e1 SMART
LRR 334 357 1.43e-1 SMART
LRRCT 369 422 4.15e-2 SMART
IGc2 437 504 1.58e-10 SMART
transmembrane domain 560 582 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210032
AA Change: F349S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (108/112)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit early-onset CNS myelination. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aarsd1 T C 11: 101,411,160 I196V probably benign Het
Aass T A 6: 23,075,856 K761* probably null Het
Abca13 A G 11: 9,292,306 T1390A possibly damaging Het
Abhd16a T C 17: 35,096,606 probably null Het
Acad11 C T 9: 104,095,565 Q486* probably null Het
Actl9 T C 17: 33,433,935 L323P probably benign Het
Adam12 T A 7: 133,916,462 I650F possibly damaging Het
Adgre4 A T 17: 55,784,971 D77V probably damaging Het
Ankrd26 A G 6: 118,506,485 F1586S possibly damaging Het
Anpep T C 7: 79,839,465 T320A probably benign Het
Arl15 T A 13: 113,967,725 C133S probably benign Het
Ascc3 A G 10: 50,720,664 N1230S possibly damaging Het
Atf4 T A 15: 80,257,417 I336K probably damaging Het
Atp7b A T 8: 22,000,121 S1044T probably benign Het
Atp8b4 A G 2: 126,414,293 F249L probably damaging Het
AU021092 G T 16: 5,212,193 N319K probably benign Het
Bbs4 A G 9: 59,323,519 V440A probably benign Het
Bpifb4 G T 2: 153,950,385 G450C probably damaging Het
Cadm1 G A 9: 47,818,822 probably benign Het
Ccser2 G A 14: 36,938,697 L500F probably damaging Het
Cd22 T A 7: 30,876,153 I155F probably damaging Het
Cdkl4 A T 17: 80,543,652 V207E probably damaging Het
Cfap65 T C 1: 74,918,908 D947G probably damaging Het
Cntn6 T C 6: 104,804,360 V397A probably benign Het
Cpox T A 16: 58,677,969 Y388* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dda1 T A 8: 71,473,810 Y58N probably damaging Het
Dennd4a C T 9: 64,897,357 T1326I possibly damaging Het
Eps8l2 A T 7: 141,357,260 I338F probably damaging Het
Fbxo42 A G 4: 141,199,809 T467A probably benign Het
Flt4 T C 11: 49,626,808 F319S possibly damaging Het
Fmn1 A T 2: 113,584,071 Y895F possibly damaging Het
Gm6887 C A 7: 42,465,093 noncoding transcript Het
Grid2 A G 6: 64,665,915 D887G probably benign Het
Grm6 C T 11: 50,863,010 P714S probably damaging Het
Gsto2 A G 19: 47,884,656 I157V probably benign Het
Il15ra A G 2: 11,718,345 probably null Het
Impg1 A G 9: 80,314,400 F713L probably benign Het
Jag1 T A 2: 137,094,456 T373S probably benign Het
Kcnh3 T A 15: 99,241,945 L904Q probably benign Het
Kctd19 C A 8: 105,390,429 G356V possibly damaging Het
Kdm5b T A 1: 134,606,012 probably benign Het
Kif1a T C 1: 93,078,835 I37V probably damaging Het
Lama5 G A 2: 180,191,696 R1508C probably damaging Het
Lamb1 T A 12: 31,266,848 C65* probably null Het
Loxl4 G A 19: 42,607,613 H147Y probably benign Het
Lrrn4cl T A 19: 8,852,055 N132K probably damaging Het
Med17 A T 9: 15,270,360 H31Q probably damaging Het
Med23 A T 10: 24,893,648 L476F probably damaging Het
Mgst1 A T 6: 138,150,838 D66V probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Muc4 A T 16: 32,755,846 probably benign Het
Myo18a C T 11: 77,817,665 T30M probably damaging Het
Ncapg2 G T 12: 116,440,618 R903L probably benign Het
Nme1 A G 11: 93,965,908 I9T probably damaging Het
Nmt2 T A 2: 3,322,641 I357N probably benign Het
Nphp4 T C 4: 152,496,659 F100S probably damaging Het
Oca2 C A 7: 56,255,002 T72K probably benign Het
Olfr1411 C A 1: 92,597,438 D306E probably benign Het
Olfr625-ps1 G A 7: 103,683,062 V105M probably damaging Het
Olfr676 A T 7: 105,035,591 D131V probably damaging Het
Olfr677 A T 7: 105,056,879 D211V probably damaging Het
Olfr871 T C 9: 20,212,625 I92T probably damaging Het
Plce1 A T 19: 38,725,007 T1240S probably benign Het
Plch1 A T 3: 63,699,496 probably null Het
Plxna4 T C 6: 32,516,688 D331G probably damaging Het
Ppp1r3a T C 6: 14,718,993 T641A probably benign Het
Rab32 A G 10: 10,550,854 L116P probably benign Het
Recql4 C T 15: 76,708,585 C302Y probably damaging Het
Rorc G C 3: 94,391,710 E391Q probably null Het
Saa4 A T 7: 46,731,627 F24I possibly damaging Het
Sall1 T A 8: 89,031,160 K772M probably damaging Het
Sdk1 T G 5: 142,185,231 L1950V probably damaging Het
Sil1 T C 18: 35,266,896 E352G probably benign Het
Slc26a3 C T 12: 31,447,774 P59L probably damaging Het
Smco2 T C 6: 146,861,942 probably benign Het
Sppl3 A G 5: 115,103,313 probably null Het
St6gal2 T A 17: 55,496,344 V360D probably damaging Het
Stard9 G A 2: 120,705,713 R345Q possibly damaging Het
Susd4 T A 1: 182,892,061 Y414N probably damaging Het
Tenm4 T C 7: 96,895,349 Y2191H probably damaging Het
Tln2 A G 9: 67,346,527 V754A probably benign Het
Tmem132c T A 5: 127,564,496 probably benign Het
Tnn A T 1: 160,147,768 S30T possibly damaging Het
Trpd52l3 G T 19: 30,004,495 V217F probably damaging Het
Trpm1 G T 7: 64,243,500 L1033F probably damaging Het
Tulp2 A G 7: 45,517,924 E182G probably damaging Het
Ubr4 A G 4: 139,471,336 K4490R possibly damaging Het
Usp17la A T 7: 104,860,649 R154* probably null Het
Vmn2r17 T G 5: 109,427,983 M240R probably damaging Het
Vmn2r22 T A 6: 123,650,469 N56I probably benign Het
Wdr66 A G 5: 123,322,613 K1213E probably benign Het
Zdhhc21 A T 4: 82,820,334 I206N possibly damaging Het
Zfp148 T A 16: 33,456,908 D122E probably benign Het
Zfp804a A T 2: 82,256,582 S252C probably damaging Het
Zgrf1 C T 3: 127,598,704 T1291I probably benign Het
Other mutations in Lingo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01648:Lingo1 APN 9 56619827 missense probably damaging 1.00
IGL02335:Lingo1 APN 9 56620081 missense probably damaging 1.00
IGL03093:Lingo1 APN 9 56619464 missense possibly damaging 0.90
3-1:Lingo1 UTSW 9 56620420 missense probably benign 0.02
R1840:Lingo1 UTSW 9 56620558 missense probably benign 0.38
R1932:Lingo1 UTSW 9 56619650 missense possibly damaging 0.89
R2475:Lingo1 UTSW 9 56619626 missense probably benign 0.03
R3439:Lingo1 UTSW 9 56620733 missense probably benign 0.23
R3870:Lingo1 UTSW 9 56619725 missense probably benign 0.00
R4241:Lingo1 UTSW 9 56620102 missense probably damaging 1.00
R4757:Lingo1 UTSW 9 56619925 missense probably benign 0.14
R5451:Lingo1 UTSW 9 56620427 missense probably damaging 1.00
R6190:Lingo1 UTSW 9 56619650 missense possibly damaging 0.89
R6254:Lingo1 UTSW 9 56620087 missense possibly damaging 0.55
R6836:Lingo1 UTSW 9 56619772 missense probably damaging 0.99
R6849:Lingo1 UTSW 9 56619616 missense probably damaging 1.00
R6935:Lingo1 UTSW 9 56619865 missense probably damaging 1.00
R7051:Lingo1 UTSW 9 56620183 missense probably benign 0.35
R7116:Lingo1 UTSW 9 56620627 missense probably benign 0.17
R7196:Lingo1 UTSW 9 56620619 missense probably damaging 1.00
X0023:Lingo1 UTSW 9 56620028 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGGCCCTCATCTACAAAC -3'
(R):5'- CCAATCGGTACAATCGAGGG -3'

Sequencing Primer
(F):5'- TGAAGTAGTTGGGTAGGAGTACATC -3'
(R):5'- TACAATCGAGGGCTCCATGCTG -3'
Posted On2015-10-21