Incidental Mutation 'R4757:Sv2b'
ID358239
Institutional Source Beutler Lab
Gene Symbol Sv2b
Ensembl Gene ENSMUSG00000053025
Gene Namesynaptic vesicle glycoprotein 2 b
SynonymsA830038F04Rik
MMRRC Submission 041973-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4757 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location75114894-75309262 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75124170 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 518 (T518A)
Ref Sequence ENSEMBL: ENSMUSP00000146049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085164] [ENSMUST00000165175] [ENSMUST00000206344]
Predicted Effect probably benign
Transcript: ENSMUST00000085164
AA Change: T518A

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000082254
Gene: ENSMUSG00000053025
AA Change: T518A

DomainStartEndE-ValueType
Pfam:Sugar_tr 93 415 3.8e-29 PFAM
Pfam:MFS_1 111 429 9.3e-25 PFAM
Pfam:MFS_1 517 681 8.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165175
AA Change: T518A

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127245
Gene: ENSMUSG00000053025
AA Change: T518A

DomainStartEndE-ValueType
Pfam:Sugar_tr 89 412 1.5e-29 PFAM
Pfam:MFS_1 111 429 9.5e-25 PFAM
Pfam:Pentapeptide_4 453 528 7.9e-11 PFAM
Pfam:MFS_1 516 681 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206344
AA Change: T518A

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000207001
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic vesicle proteins 2 (SV2) family and major facilitator superfamily of proteins. This protein and other members of the family are localized to synaptic vesicles and may function in the regulation of vesicle trafficking and exocytosis. Studies in mice suggest that the encoded protein may act as a protein receptor for botulinum neurotoxin E in neurons, and that this protein may be important for the integrity of the glomerular filtration barrier. This gene shows reduced expression in areas of synaptic loss in the hippocampus of human temporal lobe epilepsy patients. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for a targeted null mutation are phenotypically normal, and Sv2a/Sv2b double knockouts are no more affected than Sv2a single knockouts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930550C14Rik A T 9: 53,425,530 M45L probably benign Het
4931440F15Rik A T 11: 29,825,454 M1K probably null Het
Abcb1a T A 5: 8,737,632 V978D probably damaging Het
Acsm4 T C 7: 119,698,677 V179A probably benign Het
Agtr1a C A 13: 30,381,859 Y302* probably null Het
Akap9 T C 5: 4,008,382 I1677T probably damaging Het
Ankk1 T A 9: 49,415,930 M650L probably benign Het
Apod T A 16: 31,303,462 N65Y probably damaging Het
Bcl2l1 T A 2: 152,782,258 N197Y possibly damaging Het
Brpf1 A T 6: 113,315,111 I373F probably damaging Het
Car13 T C 3: 14,661,555 V257A probably damaging Het
Ccdc150 A T 1: 54,278,715 H271L possibly damaging Het
Cit T A 5: 115,997,549 I1836N probably damaging Het
Clec12b A G 6: 129,380,692 S68P probably damaging Het
Col4a4 A G 1: 82,528,466 F298L unknown Het
Crct1 G A 3: 93,014,786 Q15* probably null Het
Creld1 A G 6: 113,492,247 E346G probably benign Het
Ctnnal1 T A 4: 56,847,980 H53L probably damaging Het
Cyb5d1 T C 11: 69,394,988 D74G probably damaging Het
Deptor A T 15: 55,212,278 S293C probably damaging Het
Dnajb12 A G 10: 59,892,770 S187G probably benign Het
Duoxa2 G T 2: 122,300,591 V78L possibly damaging Het
Fhod1 C A 8: 105,347,811 probably benign Het
Foxf2 C T 13: 31,626,189 P37L unknown Het
Gabbr2 T C 4: 46,875,675 N149S probably damaging Het
Gckr G T 5: 31,307,384 M344I possibly damaging Het
Gm10354 T A 5: 14,976,208 H145L probably benign Het
Herc6 G A 6: 57,600,060 probably null Het
Igf1 A T 10: 87,915,425 E161V probably benign Het
Ighv8-13 T A 12: 115,765,648 probably benign Het
Igkv6-14 A T 6: 70,435,442 L12* probably null Het
Kpnb1 C T 11: 97,177,334 S270N possibly damaging Het
Lingo1 A G 9: 56,619,925 V460A probably benign Het
Lsm6 T C 8: 78,813,082 probably null Het
Mccc1 C T 3: 35,995,917 G42E probably benign Het
Mga A G 2: 119,903,639 K323E possibly damaging Het
Mks1 A G 11: 87,863,024 *562W probably null Het
Mrgpra4 T A 7: 47,980,938 E305V probably damaging Het
Msh4 T A 3: 153,879,387 H360L probably damaging Het
Mthfsd C T 8: 121,098,998 probably null Het
Myl12a A T 17: 70,996,803 F26L possibly damaging Het
Nedd4l A G 18: 65,165,605 S343G probably damaging Het
Nlgn1 T A 3: 25,436,168 D465V probably damaging Het
Nlgn1 C T 3: 25,436,343 V407I possibly damaging Het
Npsr1 T C 9: 24,134,768 V61A probably benign Het
Nrxn2 A G 19: 6,509,821 D160G probably damaging Het
Olfr1006 A G 2: 85,674,320 F277S probably damaging Het
Olfr1370 T C 13: 21,072,545 Y252C probably damaging Het
Olfr1461 A C 19: 13,165,913 S300R probably benign Het
Olfr1467 G T 19: 13,365,446 A273S probably benign Het
Olfr653 T C 7: 104,580,197 Y184H possibly damaging Het
Pbx1 C A 1: 168,195,881 R235L probably damaging Het
Pcnx4 T C 12: 72,556,293 V443A probably benign Het
Pde7b T C 10: 20,547,942 T63A probably benign Het
Phf3 C T 1: 30,820,827 G873D probably damaging Het
Phox2b A T 5: 67,098,854 Y30N probably damaging Het
Plch2 T A 4: 154,996,233 I599F possibly damaging Het
Plekha8 A G 6: 54,622,228 E249G probably benign Het
Pou2af1 T A 9: 51,233,139 Y118N possibly damaging Het
Ppp3cc T A 14: 70,218,186 K489N possibly damaging Het
Sema4b T C 7: 80,216,829 L219P probably damaging Het
Slc6a5 T G 7: 49,959,282 V745G probably benign Het
Slf2 A G 19: 44,935,058 M104V probably benign Het
Slx1b A G 7: 126,692,529 V121A probably benign Het
Spen T A 4: 141,473,079 K2746* probably null Het
Stxbp5l T C 16: 37,188,634 Y681C probably damaging Het
Tgm7 A T 2: 121,096,389 H426Q possibly damaging Het
Tlx2 A G 6: 83,069,919 F54S probably benign Het
Trp53bp2 A T 1: 182,458,774 M1060L probably benign Het
Trpv5 T A 6: 41,653,214 E647D probably damaging Het
Tut1 G T 19: 8,959,308 K165N possibly damaging Het
Tyro3 A G 2: 119,810,938 K543E probably damaging Het
Vmn2r69 T A 7: 85,412,367 Y133F probably damaging Het
Zfhx4 T A 3: 5,400,062 V1785D possibly damaging Het
Zfp451 A G 1: 33,765,858 L1037P probably damaging Het
Zscan29 A T 2: 121,160,911 F799I possibly damaging Het
Other mutations in Sv2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01463:Sv2b APN 7 75136455 missense probably damaging 1.00
IGL02302:Sv2b APN 7 75124199 missense probably damaging 0.98
IGL02352:Sv2b APN 7 75136449 missense probably benign 0.01
IGL02359:Sv2b APN 7 75136449 missense probably benign 0.01
IGL02698:Sv2b APN 7 75140978 critical splice donor site probably null
IGL02713:Sv2b APN 7 75124163 missense possibly damaging 0.66
IGL03075:Sv2b APN 7 75136320 missense probably benign
IGL03392:Sv2b APN 7 75156760 critical splice acceptor site probably null
R0015:Sv2b UTSW 7 75125641 missense probably damaging 1.00
R0033:Sv2b UTSW 7 75117741 missense probably benign 0.00
R0033:Sv2b UTSW 7 75117741 missense probably benign 0.00
R0219:Sv2b UTSW 7 75157267 critical splice donor site probably null
R0277:Sv2b UTSW 7 75206439 missense possibly damaging 0.62
R0469:Sv2b UTSW 7 75136392 missense probably benign
R0510:Sv2b UTSW 7 75136392 missense probably benign
R1219:Sv2b UTSW 7 75136412 missense probably benign 0.01
R1307:Sv2b UTSW 7 75206434 missense probably damaging 1.00
R1476:Sv2b UTSW 7 75120043 missense possibly damaging 0.72
R1520:Sv2b UTSW 7 75157329 missense probably damaging 0.98
R1575:Sv2b UTSW 7 75147677 missense probably damaging 0.97
R1585:Sv2b UTSW 7 75147677 missense probably damaging 0.97
R1666:Sv2b UTSW 7 75206341 missense probably benign 0.01
R1712:Sv2b UTSW 7 75149059 missense possibly damaging 0.78
R1864:Sv2b UTSW 7 75124080 missense probably benign 0.17
R1993:Sv2b UTSW 7 75206341 missense probably benign 0.01
R2191:Sv2b UTSW 7 75124088 missense probably damaging 1.00
R3836:Sv2b UTSW 7 75157428 missense probably damaging 1.00
R4744:Sv2b UTSW 7 75206518 missense probably benign 0.01
R4924:Sv2b UTSW 7 75136421 missense probably benign 0.20
R4990:Sv2b UTSW 7 75117722 missense possibly damaging 0.55
R4991:Sv2b UTSW 7 75117722 missense possibly damaging 0.55
R5038:Sv2b UTSW 7 75157425 missense probably damaging 1.00
R5726:Sv2b UTSW 7 75124214 missense possibly damaging 0.67
R5885:Sv2b UTSW 7 75156753 missense probably damaging 1.00
R6379:Sv2b UTSW 7 75136300 missense possibly damaging 0.73
R6410:Sv2b UTSW 7 75140109 missense probably benign 0.40
R6623:Sv2b UTSW 7 75206384 missense probably damaging 1.00
R6709:Sv2b UTSW 7 75124139 missense probably benign 0.40
R6873:Sv2b UTSW 7 75206206 missense probably damaging 1.00
R6889:Sv2b UTSW 7 75125767 intron probably null
R7123:Sv2b UTSW 7 75117702 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTTGGTTTAACAGCAGCAG -3'
(R):5'- TCTAGGAACTTGAGCAGATTATCAC -3'

Sequencing Primer
(F):5'- CTTGGTTTAACAGCAGCAGATCCAG -3'
(R):5'- CATTTTTGGACAAACATCACTGTGAC -3'
Posted On2015-11-11