Incidental Mutation 'R4837:Ranbp17'
ID374350
Institutional Source Beutler Lab
Gene Symbol Ranbp17
Ensembl Gene ENSMUSG00000040594
Gene NameRAN binding protein 17
Synonyms4932704E15Rik
MMRRC Submission 042452-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.655) question?
Stock #R4837 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location33211795-33513746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33328451 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 139 (S139P)
Ref Sequence ENSEMBL: ENSMUSP00000147123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102815] [ENSMUST00000129179] [ENSMUST00000207401]
Predicted Effect probably damaging
Transcript: ENSMUST00000102815
AA Change: S620P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099879
Gene: ENSMUSG00000040594
AA Change: S620P

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129179
SMART Domains Protein: ENSMUSP00000137898
Gene: ENSMUSG00000040594

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154808
Predicted Effect probably damaging
Transcript: ENSMUST00000207401
AA Change: S139P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-17 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,246,980 H618L probably benign Het
Adgrl3 A G 5: 81,766,234 T1230A probably benign Het
Ahnak2 A G 12: 112,785,739 S203P probably benign Het
Allc A G 12: 28,559,309 V244A probably benign Het
Ap3m1 G A 14: 21,037,157 P157L probably damaging Het
Arhgef2 T G 3: 88,632,943 I97S probably damaging Het
Btaf1 C A 19: 36,966,785 T398K probably benign Het
Cabp1 T C 5: 115,173,153 M158V probably damaging Het
Ccdc162 G A 10: 41,673,867 P340L probably benign Het
Clip4 A G 17: 71,834,222 K524E probably damaging Het
Cltc A G 11: 86,695,648 V189A probably benign Het
Cmc2 A G 8: 116,894,140 F34S probably damaging Het
Ctcfl G T 2: 173,113,656 T271N probably benign Het
Cyp4f16 T A 17: 32,542,764 F124I possibly damaging Het
Ddx41 C A 13: 55,531,648 R479L possibly damaging Het
Dgcr6 C A 16: 18,066,846 N87K possibly damaging Het
Dll1 A G 17: 15,368,859 L518P probably damaging Het
Dnaja4 G T 9: 54,710,644 M263I probably benign Het
Dusp13 T A 14: 21,743,525 probably benign Het
Fam185a T A 5: 21,480,377 I357N probably benign Het
Fam186a T C 15: 99,940,797 Y2522C unknown Het
Fam222a T A 5: 114,594,397 C4* probably null Het
Filip1 T C 9: 79,819,459 D626G probably damaging Het
Ghrhr C T 6: 55,388,187 R389C probably damaging Het
Gm8251 G A 1: 44,061,434 T168I possibly damaging Het
Gstm3 T A 3: 107,964,215 T217S probably benign Het
Gucy2g T C 19: 55,226,053 T548A probably benign Het
Hectd3 T A 4: 117,002,597 C744S probably null Het
Hnrnpl T C 7: 28,817,337 S184P probably benign Het
Il3 G A 11: 54,267,257 probably benign Het
Itga5 C T 15: 103,354,084 G330S probably damaging Het
Kl A G 5: 150,980,847 T355A possibly damaging Het
Lipk A C 19: 34,032,320 S208R probably damaging Het
Mrs2 T A 13: 24,999,057 probably null Het
Mutyh A G 4: 116,817,690 E372G probably damaging Het
Myh4 C A 11: 67,258,992 A1821D probably benign Het
Nfkb2 G T 19: 46,307,567 E170D probably benign Het
Nlrp12 T C 7: 3,231,061 E881G probably damaging Het
Nol9 T C 4: 152,052,095 probably benign Het
Nwd1 A G 8: 72,657,131 E52G probably damaging Het
Olfr1025-ps1 A G 2: 85,918,404 T160A probably benign Het
Olfr1294 T A 2: 111,537,974 H105L probably damaging Het
Olfr1415 A G 1: 92,490,975 V260A probably benign Het
Olfr1508 A T 14: 52,463,646 M121K probably damaging Het
Olfr449 T G 6: 42,837,849 probably null Het
Opn4 A G 14: 34,596,304 V242A probably damaging Het
Paxbp1 G A 16: 91,034,978 Q341* probably null Het
Pcdh7 T C 5: 57,720,411 V436A possibly damaging Het
Pcdhb18 G A 18: 37,489,814 V66M probably damaging Het
Pikfyve A G 1: 65,246,590 E951G possibly damaging Het
Plcg1 A G 2: 160,750,986 N179S probably benign Het
Prr11 A C 11: 87,098,691 S285A probably benign Het
Rasa4 G A 5: 136,091,810 probably null Het
Rnf213 G C 11: 119,442,763 G2934R probably benign Het
Rpap1 A G 2: 119,778,251 V210A probably benign Het
Rpn1 T A 6: 88,090,205 N182K probably benign Het
Rps24 C T 14: 24,491,787 T14I possibly damaging Het
Rrp12 C T 19: 41,877,505 probably null Het
Rttn T A 18: 89,090,415 probably null Het
Rufy1 A G 11: 50,401,493 S490P probably damaging Het
Sec62 T A 3: 30,809,869 M100K unknown Het
Spata16 A G 3: 26,732,932 H253R possibly damaging Het
Srcap T C 7: 127,558,962 probably benign Het
Srrm1 A G 4: 135,345,512 probably benign Het
Tbcd G A 11: 121,582,785 probably null Het
Tedc2 C A 17: 24,220,593 A25S probably damaging Het
Tnr A T 1: 159,684,788 probably benign Het
Tnxb A C 17: 34,718,007 D3730A probably damaging Het
Tor2a G A 2: 32,760,597 G201D probably damaging Het
Tpp1 T C 7: 105,746,649 T558A probably benign Het
Vmn1r211 G T 13: 22,852,126 Q124K probably benign Het
Wasf3 T C 5: 146,460,978 V185A probably benign Het
Zbtb12 A G 17: 34,896,009 T257A probably benign Het
Other mutations in Ranbp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ranbp17 APN 11 33493402 missense probably benign 0.13
IGL00582:Ranbp17 APN 11 33504683 missense probably damaging 0.99
IGL00698:Ranbp17 APN 11 33441910 missense probably benign 0.00
IGL00789:Ranbp17 APN 11 33243249 missense probably benign 0.27
IGL01304:Ranbp17 APN 11 33266147 missense possibly damaging 0.91
IGL01936:Ranbp17 APN 11 33487689 missense probably benign 0.00
IGL01937:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01945:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01993:Ranbp17 APN 11 33500770 missense possibly damaging 0.48
IGL02588:Ranbp17 APN 11 33217361 missense probably benign
IGL02870:Ranbp17 APN 11 33243262 missense probably damaging 1.00
IGL03149:Ranbp17 APN 11 33243183 missense possibly damaging 0.76
R0079:Ranbp17 UTSW 11 33500682 missense probably damaging 1.00
R0349:Ranbp17 UTSW 11 33500689 missense probably benign
R0395:Ranbp17 UTSW 11 33474896 missense probably benign
R1456:Ranbp17 UTSW 11 33266310 missense probably damaging 1.00
R1539:Ranbp17 UTSW 11 33297394 missense probably damaging 0.99
R1542:Ranbp17 UTSW 11 33264672 missense probably benign
R1770:Ranbp17 UTSW 11 33217301 missense probably benign 0.31
R2216:Ranbp17 UTSW 11 33481125 missense probably damaging 1.00
R2656:Ranbp17 UTSW 11 33243122 missense probably benign
R2883:Ranbp17 UTSW 11 33504708 missense probably damaging 1.00
R3498:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3499:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3721:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3788:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3790:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3914:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3915:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3949:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4021:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4022:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4027:Ranbp17 UTSW 11 33500718 missense possibly damaging 0.67
R4421:Ranbp17 UTSW 11 33475056 missense probably benign 0.01
R4462:Ranbp17 UTSW 11 33217421 critical splice acceptor site probably null
R4659:Ranbp17 UTSW 11 33266288 missense probably damaging 1.00
R4791:Ranbp17 UTSW 11 33487746 missense probably benign 0.11
R4914:Ranbp17 UTSW 11 33213425 missense probably benign
R4939:Ranbp17 UTSW 11 33219223 missense probably benign 0.31
R5119:Ranbp17 UTSW 11 33404181 makesense probably null
R5171:Ranbp17 UTSW 11 33217419 missense probably benign
R5182:Ranbp17 UTSW 11 33219287 intron probably benign
R5288:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5384:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5385:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5398:Ranbp17 UTSW 11 33474998 missense probably damaging 1.00
R6658:Ranbp17 UTSW 11 33219214 nonsense probably null
R6701:Ranbp17 UTSW 11 33475066 missense probably damaging 1.00
R6796:Ranbp17 UTSW 11 33217398 missense probably benign
R6869:Ranbp17 UTSW 11 33513074 start gained probably benign
X0013:Ranbp17 UTSW 11 33289562 unclassified probably null
X0024:Ranbp17 UTSW 11 33213404 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGCATGTGCCTTTCTTCAAGTTAG -3'
(R):5'- CTTTGTGATTGAAGGCACCTAAC -3'

Sequencing Primer
(F):5'- GTGCCTTTCTTCAAGTTAGTTACATG -3'
(R):5'- GAAGGCACCTAACTTACATGTG -3'
Posted On2016-03-01