Incidental Mutation 'R6869:Ranbp17'
ID536099
Institutional Source Beutler Lab
Gene Symbol Ranbp17
Ensembl Gene ENSMUSG00000040594
Gene NameRAN binding protein 17
Synonyms4932704E15Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R6869 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location33211795-33513746 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to C at 33513074 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000118519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037522] [ENSMUST00000102815] [ENSMUST00000129179] [ENSMUST00000147751]
Predicted Effect probably benign
Transcript: ENSMUST00000037522
SMART Domains Protein: ENSMUSP00000035840
Gene: ENSMUSG00000040594

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102815
SMART Domains Protein: ENSMUSP00000099879
Gene: ENSMUSG00000040594

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129179
SMART Domains Protein: ENSMUSP00000137898
Gene: ENSMUSG00000040594

DomainStartEndE-ValueType
IBN_N 30 95 3.24e-5 SMART
low complexity region 270 283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147751
SMART Domains Protein: ENSMUSP00000118519
Gene: ENSMUSG00000040594

DomainStartEndE-ValueType
IBN_N 25 90 3.24e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-17 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankdd1b A T 13: 96,444,291 N166K possibly damaging Het
Arhgap30 G T 1: 171,409,055 R999L probably damaging Het
Bnc2 T A 4: 84,293,496 D212V probably damaging Het
Bpifb5 T C 2: 154,233,223 I357T probably benign Het
Catsperb T C 12: 101,480,737 F208S probably benign Het
Cc2d2b T A 19: 40,809,454 H1105Q probably benign Het
Chd6 T C 2: 160,965,730 S1855G probably benign Het
Cpe A G 8: 64,619,427 V143A probably benign Het
Cyfip1 T A 7: 55,907,365 V770D possibly damaging Het
Cyp1a1 A T 9: 57,702,784 M494L probably benign Het
Dcstamp T C 15: 39,754,458 S88P probably damaging Het
Dnah2 T A 11: 69,429,471 N3924I probably damaging Het
F830045P16Rik T C 2: 129,474,561 E76G probably damaging Het
Fam91a1 T A 15: 58,431,268 V342E probably benign Het
Fastkd1 G A 2: 69,702,760 A421V probably benign Het
Fgf20 T C 8: 40,281,148 Y64C probably damaging Het
Gen1 A T 12: 11,241,441 N847K probably benign Het
Gm438 A T 4: 144,780,472 probably null Het
Gm4922 A T 10: 18,784,515 I153K probably damaging Het
Gm6619 T C 6: 131,486,438 I6T unknown Het
H2-Ab1 T C 17: 34,267,563 Y199H probably damaging Het
Hdac7 C A 15: 97,796,176 L737F probably damaging Het
Hells A G 19: 38,940,635 N121D probably benign Het
Itga2 G A 13: 114,875,537 probably null Het
Itgb1 A G 8: 128,720,035 D391G probably benign Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lbx1 T A 19: 45,234,951 S93C probably damaging Het
Lmod2 T C 6: 24,604,127 M367T probably benign Het
Lrrc43 G A 5: 123,504,276 probably null Het
Man2a2 C T 7: 80,362,945 G574D probably benign Het
Mier2 T G 10: 79,542,669 K343T probably damaging Het
Mtus1 T C 8: 41,082,654 Q675R possibly damaging Het
Ncan A T 8: 70,107,907 H803Q probably benign Het
Nckap5l A G 15: 99,426,453 V723A probably damaging Het
Nectin3 G A 16: 46,395,143 R79C probably damaging Het
Nlrc5 A G 8: 94,521,955 E1735G probably benign Het
Nrros A G 16: 32,144,431 L220S probably damaging Het
Olfr1107 T A 2: 87,071,673 I154F probably benign Het
Olfr584 G A 7: 103,085,868 V112M possibly damaging Het
Oxa1l C T 14: 54,366,738 P152S probably damaging Het
Pdcd6ip A G 9: 113,655,106 Y818H unknown Het
Pik3cb A T 9: 99,060,259 S682T probably benign Het
Ppp1r3a A C 6: 14,754,826 S141A probably benign Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Ptprk T C 10: 28,473,059 probably null Het
Rcbtb1 T C 14: 59,217,602 V95A probably benign Het
Retreg3 G A 11: 101,119,818 probably benign Het
Rhobtb1 T C 10: 69,270,226 L207P probably damaging Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Sh3bgr A G 16: 96,206,660 Y75C probably damaging Het
Strip1 T C 3: 107,613,445 D763G probably damaging Het
Stxbp5l A T 16: 37,204,448 V596E possibly damaging Het
Tas2r138 A G 6: 40,612,421 I297T probably damaging Het
Topors A C 4: 40,261,201 N694K unknown Het
Tymp T C 15: 89,376,691 R20G probably benign Het
Ubr4 A G 4: 139,467,227 T1144A possibly damaging Het
Unc79 A T 12: 103,113,072 Q1636L probably benign Het
Vmn1r78 A G 7: 12,152,749 M96V probably benign Het
Wfdc8 C T 2: 164,599,092 D244N possibly damaging Het
Zbtb49 G T 5: 38,214,350 N62K probably damaging Het
Zfp579 G T 7: 4,994,461 D150E probably benign Het
Other mutations in Ranbp17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ranbp17 APN 11 33493402 missense probably benign 0.13
IGL00582:Ranbp17 APN 11 33504683 missense probably damaging 0.99
IGL00698:Ranbp17 APN 11 33441910 missense probably benign 0.00
IGL00789:Ranbp17 APN 11 33243249 missense probably benign 0.27
IGL01304:Ranbp17 APN 11 33266147 missense possibly damaging 0.91
IGL01936:Ranbp17 APN 11 33487689 missense probably benign 0.00
IGL01937:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01945:Ranbp17 APN 11 33328520 missense possibly damaging 0.73
IGL01993:Ranbp17 APN 11 33500770 missense possibly damaging 0.48
IGL02588:Ranbp17 APN 11 33217361 missense probably benign
IGL02870:Ranbp17 APN 11 33243262 missense probably damaging 1.00
IGL03149:Ranbp17 APN 11 33243183 missense possibly damaging 0.76
R0079:Ranbp17 UTSW 11 33500682 missense probably damaging 1.00
R0349:Ranbp17 UTSW 11 33500689 missense probably benign
R0395:Ranbp17 UTSW 11 33474896 missense probably benign
R1456:Ranbp17 UTSW 11 33266310 missense probably damaging 1.00
R1539:Ranbp17 UTSW 11 33297394 missense probably damaging 0.99
R1542:Ranbp17 UTSW 11 33264672 missense probably benign
R1770:Ranbp17 UTSW 11 33217301 missense probably benign 0.31
R2216:Ranbp17 UTSW 11 33481125 missense probably damaging 1.00
R2656:Ranbp17 UTSW 11 33243122 missense probably benign
R2883:Ranbp17 UTSW 11 33504708 missense probably damaging 1.00
R3498:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3499:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3721:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3788:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3790:Ranbp17 UTSW 11 33219203 small deletion probably benign
R3914:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3915:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R3949:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4021:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4022:Ranbp17 UTSW 11 33479189 missense probably benign 0.02
R4027:Ranbp17 UTSW 11 33500718 missense possibly damaging 0.67
R4421:Ranbp17 UTSW 11 33475056 missense probably benign 0.01
R4462:Ranbp17 UTSW 11 33217421 critical splice acceptor site probably null
R4659:Ranbp17 UTSW 11 33266288 missense probably damaging 1.00
R4791:Ranbp17 UTSW 11 33487746 missense probably benign 0.11
R4837:Ranbp17 UTSW 11 33328451 missense probably damaging 1.00
R4914:Ranbp17 UTSW 11 33213425 missense probably benign
R4939:Ranbp17 UTSW 11 33219223 missense probably benign 0.31
R5119:Ranbp17 UTSW 11 33404181 makesense probably null
R5171:Ranbp17 UTSW 11 33217419 missense probably benign
R5182:Ranbp17 UTSW 11 33219287 intron probably benign
R5288:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5384:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5385:Ranbp17 UTSW 11 33219241 missense possibly damaging 0.75
R5398:Ranbp17 UTSW 11 33474998 missense probably damaging 1.00
R6658:Ranbp17 UTSW 11 33219214 nonsense probably null
R6701:Ranbp17 UTSW 11 33475066 missense probably damaging 1.00
R6796:Ranbp17 UTSW 11 33217398 missense probably benign
X0013:Ranbp17 UTSW 11 33289562 unclassified probably null
X0024:Ranbp17 UTSW 11 33213404 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCCCTGAGAGTACAAGGCAG -3'
(R):5'- AGATGGCGCTGCACTTTCAG -3'

Sequencing Primer
(F):5'- TACAAGGCAGCGAGTTTGC -3'
(R):5'- AGAGGACTGTCATTGGCCG -3'
Posted On2018-10-18