Incidental Mutation 'R4873:Sp9'
ID376807
Institutional Source Beutler Lab
Gene Symbol Sp9
Ensembl Gene ENSMUSG00000068859
Gene Nametrans-acting transcription factor 9
Synonyms
MMRRC Submission 042483-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.610) question?
Stock #R4873 (G1)
Quality Score87
Status Validated
Chromosome2
Chromosomal Location73271925-73284706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73273618 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 172 (V172A)
Ref Sequence ENSEMBL: ENSMUSP00000088322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090813]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090813
AA Change: V172A

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088322
Gene: ENSMUSG00000068859
AA Change: V172A

DomainStartEndE-ValueType
low complexity region 53 65 N/A INTRINSIC
low complexity region 71 88 N/A INTRINSIC
low complexity region 92 103 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 268 306 N/A INTRINSIC
ZnF_C2H2 332 356 2.63e0 SMART
ZnF_C2H2 362 386 1.84e-4 SMART
ZnF_C2H2 392 414 5.99e-4 SMART
low complexity region 416 427 N/A INTRINSIC
low complexity region 452 472 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147133
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,631,177 E119D probably benign Het
Alox5 A T 6: 116,413,850 probably null Het
Atad5 T C 11: 80,120,689 V1294A probably damaging Het
BB019430 A G 10: 58,704,043 noncoding transcript Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Catsperb A T 12: 101,587,985 N646I possibly damaging Het
Ccdc112 A G 18: 46,296,289 I114T probably damaging Het
Cecr2 T C 6: 120,750,916 L340P probably damaging Het
Ces2e T A 8: 104,927,185 V85E probably damaging Het
Cnpy2 C A 10: 128,326,095 T79K probably damaging Het
Cntn4 G A 6: 106,437,913 R135H possibly damaging Het
Cyp3a16 C A 5: 145,452,849 M235I probably benign Het
Dll3 A G 7: 28,296,435 C314R probably damaging Het
Dnah7c A G 1: 46,688,925 N2928D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dqx1 C A 6: 83,061,012 D460E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ehbp1 A G 11: 22,101,164 C438R probably damaging Het
Ehd3 T G 17: 73,805,304 V21G probably damaging Het
Ero1lb G A 13: 12,604,436 V440I probably damaging Het
Fpgt G A 3: 155,087,913 A159V probably damaging Het
Gcn1l1 T C 5: 115,576,170 L123P possibly damaging Het
Gm14496 A T 2: 181,997,433 R439W probably damaging Het
Gm20767 T C 13: 120,154,670 V15A probably damaging Het
Gm4353 G C 7: 116,084,413 P49R probably damaging Het
Gsdmc2 C T 15: 63,828,252 A224T probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcns1 T C 2: 164,168,101 Y246C probably damaging Het
Kif26b A G 1: 178,915,327 E549G probably benign Het
Krt9 T C 11: 100,190,037 I330V probably benign Het
Lair1 A T 7: 4,029,034 S25T probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Luzp2 A G 7: 55,167,248 I149V possibly damaging Het
Mcoln1 T A 8: 3,507,422 S143T probably benign Het
Mcph1 A G 8: 18,625,558 probably null Het
Mgat5 G A 1: 127,469,249 V578M probably damaging Het
Mis18bp1 G A 12: 65,161,435 T168M probably benign Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myom1 T C 17: 71,072,119 V626A probably damaging Het
Nat6 C T 9: 107,583,619 R238C probably damaging Het
Ncam1 T C 9: 49,507,621 probably benign Het
Nlrp2 A T 7: 5,298,859 F211L probably benign Het
Olfr1368 T A 13: 21,142,280 Y259F probably damaging Het
Olfr1495 T A 19: 13,768,762 M140K probably damaging Het
Olfr517 A T 7: 108,868,786 F123I probably damaging Het
Osbpl11 G A 16: 33,234,493 V649I probably benign Het
Oscar A T 7: 3,616,017 probably null Het
Pax8 T A 2: 24,441,640 M144L probably benign Het
Pcnt T C 10: 76,369,854 T2555A probably benign Het
Plat T A 8: 22,768,450 I23K probably benign Het
Plpp2 G A 10: 79,530,929 T51M probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Prl7c1 T C 13: 27,773,759 M233V probably benign Het
Prox1 A C 1: 190,162,122 F42C probably damaging Het
Pwwp2b A T 7: 139,256,062 Q473L possibly damaging Het
Rims4 A T 2: 163,865,523 N127K probably null Het
Scn1a T C 2: 66,328,476 T367A possibly damaging Het
Slc23a2 A G 2: 132,056,880 I579T possibly damaging Het
Spta1 T A 1: 174,175,830 L109Q probably damaging Het
Synj2 A T 17: 5,988,068 probably benign Het
Tnrc18 A T 5: 142,765,177 M1216K unknown Het
Tpst2 T A 5: 112,309,821 Y69* probably null Het
Tpx2 C A 2: 152,893,615 A721E probably benign Het
Trmt1l A G 1: 151,455,004 T591A probably benign Het
Tubgcp4 T A 2: 121,184,849 probably benign Het
Ubiad1 T C 4: 148,444,099 T118A possibly damaging Het
Unc13c T C 9: 73,517,284 T2017A probably damaging Het
Vmn1r59 G T 7: 5,454,109 N217K probably benign Het
Vmn2r87 T C 10: 130,472,498 I624V probably damaging Het
Wdr4 A G 17: 31,499,155 V315A probably benign Het
Xpo7 T C 14: 70,676,816 probably null Het
Zfp827 T A 8: 79,060,774 W190R probably damaging Het
Zfp971 A G 2: 178,033,147 T180A probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Sp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03129:Sp9 APN 2 73273521 missense probably benign 0.00
R0604:Sp9 UTSW 2 73273638 missense probably benign 0.00
R0718:Sp9 UTSW 2 73273827 missense possibly damaging 0.70
R3423:Sp9 UTSW 2 73273971 missense probably benign 0.00
R3747:Sp9 UTSW 2 73274308 missense probably damaging 0.98
R4335:Sp9 UTSW 2 73274289 missense probably damaging 1.00
R4875:Sp9 UTSW 2 73273618 missense possibly damaging 0.86
R5341:Sp9 UTSW 2 73274514 missense possibly damaging 0.92
R5389:Sp9 UTSW 2 73274297 missense probably damaging 0.99
R5891:Sp9 UTSW 2 73274251 missense probably damaging 1.00
R6938:Sp9 UTSW 2 73273272 missense probably damaging 0.99
R7092:Sp9 UTSW 2 73273771 missense probably damaging 0.99
Z1088:Sp9 UTSW 2 73273230 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GACTATGGCGGCCTTTTCTC -3'
(R):5'- ACGTCTTGCCGTACACCTTG -3'

Sequencing Primer
(F):5'- TTCTCCAACTCGGCGGC -3'
(R):5'- CGAAATCATAGCGCTGGCG -3'
Posted On2016-03-17