Incidental Mutation 'R4873:Scn1a'
ID376806
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Namesodium channel, voltage-gated, type I, alpha
SynonymsNav1.1
MMRRC Submission 042483-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4873 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66270778-66440840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66328476 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 367 (T367A)
Ref Sequence ENSEMBL: ENSMUSP00000116881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000138910]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077489
AA Change: T367A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: T367A

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000094951
AA Change: T367A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: T367A

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112366
AA Change: T367A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: T367A

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112371
AA Change: T367A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: T367A

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000138910
AA Change: T367A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116881
Gene: ENSMUSG00000064329
AA Change: T367A

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
transmembrane domain 125 147 N/A INTRINSIC
Meta Mutation Damage Score 0.33 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak1 A T 2: 32,631,177 E119D probably benign Het
Alox5 A T 6: 116,413,850 probably null Het
Atad5 T C 11: 80,120,689 V1294A probably damaging Het
BB019430 A G 10: 58,704,043 noncoding transcript Het
Bbs9 T C 9: 22,578,715 F261L probably benign Het
Catsperb A T 12: 101,587,985 N646I possibly damaging Het
Ccdc112 A G 18: 46,296,289 I114T probably damaging Het
Cecr2 T C 6: 120,750,916 L340P probably damaging Het
Ces2e T A 8: 104,927,185 V85E probably damaging Het
Cnpy2 C A 10: 128,326,095 T79K probably damaging Het
Cntn4 G A 6: 106,437,913 R135H possibly damaging Het
Cyp3a16 C A 5: 145,452,849 M235I probably benign Het
Dll3 A G 7: 28,296,435 C314R probably damaging Het
Dnah7c A G 1: 46,688,925 N2928D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dqx1 C A 6: 83,061,012 D460E probably benign Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Ehbp1 A G 11: 22,101,164 C438R probably damaging Het
Ehd3 T G 17: 73,805,304 V21G probably damaging Het
Ero1lb G A 13: 12,604,436 V440I probably damaging Het
Fpgt G A 3: 155,087,913 A159V probably damaging Het
Gcn1l1 T C 5: 115,576,170 L123P possibly damaging Het
Gm14496 A T 2: 181,997,433 R439W probably damaging Het
Gm20767 T C 13: 120,154,670 V15A probably damaging Het
Gm4353 G C 7: 116,084,413 P49R probably damaging Het
Gsdmc2 C T 15: 63,828,252 A224T probably benign Het
Hnf1a T C 5: 114,970,673 T58A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kcns1 T C 2: 164,168,101 Y246C probably damaging Het
Kif26b A G 1: 178,915,327 E549G probably benign Het
Krt9 T C 11: 100,190,037 I330V probably benign Het
Lair1 A T 7: 4,029,034 S25T probably benign Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Luzp2 A G 7: 55,167,248 I149V possibly damaging Het
Mcoln1 T A 8: 3,507,422 S143T probably benign Het
Mcph1 A G 8: 18,625,558 probably null Het
Mgat5 G A 1: 127,469,249 V578M probably damaging Het
Mis18bp1 G A 12: 65,161,435 T168M probably benign Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Myom1 T C 17: 71,072,119 V626A probably damaging Het
Nat6 C T 9: 107,583,619 R238C probably damaging Het
Ncam1 T C 9: 49,507,621 probably benign Het
Nlrp2 A T 7: 5,298,859 F211L probably benign Het
Olfr1368 T A 13: 21,142,280 Y259F probably damaging Het
Olfr1495 T A 19: 13,768,762 M140K probably damaging Het
Olfr517 A T 7: 108,868,786 F123I probably damaging Het
Osbpl11 G A 16: 33,234,493 V649I probably benign Het
Oscar A T 7: 3,616,017 probably null Het
Pax8 T A 2: 24,441,640 M144L probably benign Het
Pcnt T C 10: 76,369,854 T2555A probably benign Het
Plat T A 8: 22,768,450 I23K probably benign Het
Plpp2 G A 10: 79,530,929 T51M probably damaging Het
Pnkp C T 7: 44,862,403 S113L probably damaging Het
Prl7c1 T C 13: 27,773,759 M233V probably benign Het
Prox1 A C 1: 190,162,122 F42C probably damaging Het
Pwwp2b A T 7: 139,256,062 Q473L possibly damaging Het
Rims4 A T 2: 163,865,523 N127K probably null Het
Slc23a2 A G 2: 132,056,880 I579T possibly damaging Het
Sp9 T C 2: 73,273,618 V172A possibly damaging Het
Spta1 T A 1: 174,175,830 L109Q probably damaging Het
Synj2 A T 17: 5,988,068 probably benign Het
Tnrc18 A T 5: 142,765,177 M1216K unknown Het
Tpst2 T A 5: 112,309,821 Y69* probably null Het
Tpx2 C A 2: 152,893,615 A721E probably benign Het
Trmt1l A G 1: 151,455,004 T591A probably benign Het
Tubgcp4 T A 2: 121,184,849 probably benign Het
Ubiad1 T C 4: 148,444,099 T118A possibly damaging Het
Unc13c T C 9: 73,517,284 T2017A probably damaging Het
Vmn1r59 G T 7: 5,454,109 N217K probably benign Het
Vmn2r87 T C 10: 130,472,498 I624V probably damaging Het
Wdr4 A G 17: 31,499,155 V315A probably benign Het
Xpo7 T C 14: 70,676,816 probably null Het
Zfp827 T A 8: 79,060,774 W190R probably damaging Het
Zfp971 A G 2: 178,033,147 T180A probably benign Het
Zfp980 G A 4: 145,702,083 G461S probably benign Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66335531 critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66280793 missense probably damaging 1.00
IGL00658:Scn1a APN 2 66286038 missense probably damaging 1.00
IGL00823:Scn1a APN 2 66324935 missense probably benign 0.04
IGL00907:Scn1a APN 2 66327797 missense probably damaging 1.00
IGL01339:Scn1a APN 2 66325960 missense probably benign 0.09
IGL01401:Scn1a APN 2 66289111 missense probably damaging 1.00
IGL01503:Scn1a APN 2 66322343 missense probably damaging 1.00
IGL01575:Scn1a APN 2 66273236 missense probably damaging 1.00
IGL01598:Scn1a APN 2 66302485 missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66285937 missense probably damaging 1.00
IGL01796:Scn1a APN 2 66332301 splice site probably benign
IGL02079:Scn1a APN 2 66323360 missense probably benign 0.14
IGL02171:Scn1a APN 2 66273199 missense probably damaging 1.00
IGL02335:Scn1a APN 2 66277661 missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66326036 missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66351153 missense probably benign 0.01
IGL02507:Scn1a APN 2 66277813 missense probably damaging 1.00
IGL02646:Scn1a APN 2 66299618 splice site probably null
IGL02729:Scn1a APN 2 66299650 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66324762 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66318077 missense probably benign 0.00
IGL02752:Scn1a APN 2 66331412 missense probably damaging 1.00
IGL02815:Scn1a APN 2 66324858 missense probably damaging 1.00
IGL03163:Scn1a APN 2 66318074 missense probably benign 0.00
IGL03229:Scn1a APN 2 66299713 missense probably damaging 1.00
IGL03286:Scn1a APN 2 66277576 missense probably damaging 0.99
IGL03393:Scn1a APN 2 66318018 missense probably benign 0.19
PIT4791001:Scn1a UTSW 2 66273282 missense probably benign 0.18
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0107:Scn1a UTSW 2 66324633 missense probably benign 0.07
R0141:Scn1a UTSW 2 66289062 missense probably damaging 1.00
R0485:Scn1a UTSW 2 66273925 missense probably damaging 0.98
R0517:Scn1a UTSW 2 66302407 missense possibly damaging 0.88
R0532:Scn1a UTSW 2 66317823 missense probably damaging 1.00
R0746:Scn1a UTSW 2 66351126 missense probably benign 0.25
R0755:Scn1a UTSW 2 66321035 missense probably damaging 1.00
R0830:Scn1a UTSW 2 66299784 missense probably damaging 1.00
R0846:Scn1a UTSW 2 66324755 missense probably benign 0.43
R0918:Scn1a UTSW 2 66323307 splice site probably null
R1055:Scn1a UTSW 2 66337996 missense probably benign 0.08
R1432:Scn1a UTSW 2 66322429 missense probably damaging 1.00
R1497:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R1512:Scn1a UTSW 2 66331285 missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66319462 nonsense probably null
R1567:Scn1a UTSW 2 66273331 missense probably damaging 1.00
R1702:Scn1a UTSW 2 66318223 missense probably damaging 1.00
R1744:Scn1a UTSW 2 66322276 missense probably benign 0.06
R1834:Scn1a UTSW 2 66324616 missense probably benign 0.04
R1834:Scn1a UTSW 2 66324617 missense probably benign 0.00
R1860:Scn1a UTSW 2 66317982 missense probably damaging 0.99
R1871:Scn1a UTSW 2 66318025 missense probably damaging 0.98
R1909:Scn1a UTSW 2 66331352 missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66328425 missense probably damaging 1.00
R1976:Scn1a UTSW 2 66331271 missense probably benign 0.02
R2291:Scn1a UTSW 2 66288968 missense probably benign 0.44
R2302:Scn1a UTSW 2 66277745 missense probably damaging 1.00
R2367:Scn1a UTSW 2 66327679 missense probably damaging 1.00
R2418:Scn1a UTSW 2 66273843 missense probably damaging 0.98
R2517:Scn1a UTSW 2 66273832 missense probably damaging 1.00
R2568:Scn1a UTSW 2 66273469 missense probably damaging 1.00
R3083:Scn1a UTSW 2 66299637 missense probably damaging 1.00
R3903:Scn1a UTSW 2 66318132 missense probably benign 0.08
R3909:Scn1a UTSW 2 66273988 missense probably damaging 1.00
R3916:Scn1a UTSW 2 66277613 missense probably damaging 1.00
R3935:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R3936:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R4043:Scn1a UTSW 2 66326036 missense possibly damaging 0.60
R4429:Scn1a UTSW 2 66350985 missense possibly damaging 0.77
R4495:Scn1a UTSW 2 66280802 critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66350988 missense probably benign 0.23
R4834:Scn1a UTSW 2 66328522 nonsense probably null
R4875:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66277801 missense probably damaging 1.00
R5255:Scn1a UTSW 2 66277669 missense probably damaging 0.99
R5435:Scn1a UTSW 2 66273534 missense probably damaging 1.00
R5449:Scn1a UTSW 2 66321002 missense probably damaging 0.96
R5519:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R5541:Scn1a UTSW 2 66324633 missense probably benign 0.07
R5556:Scn1a UTSW 2 66324797 missense probably benign 0.00
R5587:Scn1a UTSW 2 66273081 missense probably benign 0.01
R5972:Scn1a UTSW 2 66351110 missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66335456 missense probably damaging 1.00
R6195:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6233:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66273316 missense probably damaging 1.00
R6417:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6420:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6421:Scn1a UTSW 2 66272927 missense probably damaging 1.00
R6461:Scn1a UTSW 2 66326122 missense probably null 0.01
R6701:Scn1a UTSW 2 66337960 missense probably damaging 0.99
R6717:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R6834:Scn1a UTSW 2 66327742 missense probably damaging 1.00
R6918:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R6953:Scn1a UTSW 2 66319469 missense probably damaging 1.00
R6996:Scn1a UTSW 2 66287731 missense probably damaging 1.00
R7022:Scn1a UTSW 2 66317899 missense probably damaging 1.00
R7109:Scn1a UTSW 2 66350942 missense possibly damaging 0.62
R7115:Scn1a UTSW 2 66324618 nonsense probably null
R7239:Scn1a UTSW 2 66277656 intron probably null
R7434:Scn1a UTSW 2 66273045 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCGTTACTCCATTTAATGCGTATTG -3'
(R):5'- ATTCGGATTCCACACGCCTG -3'

Sequencing Primer
(F):5'- TGTAATCAATGGGTTAGAGGAGTCC -3'
(R):5'- ACGCCTGTGTCCTTTAAGTAGTGAC -3'
Posted On2016-03-17