Mutagenetix > Incidental Mutation

Incidental Mutation 'R4958:Rptor'

381719

Institutional Source

Beutler Lab

Gene Symbol

Rptor

Ensembl Gene

ENSMUSG00000025583

Gene Name

regulatory associated protein of MTOR, complex 1

Synonyms

Rap, raptor, 4932417H02Rik

MMRRC Submission

042555-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4958 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

119493731-119790402 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 119748217 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 727 (R727Q)

Ref Sequence

ENSEMBL: ENSMUSP00000026671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000124401] [ENSMUST00000131217] [ENSMUST00000147781]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026671
AA Change: R727Q

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: R727Q

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART
Pfam:HEAT_2	559	668	7.9e-11	PFAM
Pfam:HEAT	602	630	1.9e-6	PFAM
low complexity region	755	772	N/A	INTRINSIC
low complexity region	877	887	N/A	INTRINSIC
low complexity region	939	945	N/A	INTRINSIC
WD40	1012	1050	2.56e1	SMART
WD40	1052	1097	4.28e0	SMART
WD40	1105	1151	1.83e2	SMART
WD40	1154	1194	1.82e-2	SMART
WD40	1200	1240	5.35e-1	SMART
WD40	1246	1281	7.13e0	SMART
WD40	1283	1329	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124401

SMART Domains

Protein: ENSMUSP00000125503
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
Pfam:HEAT	58	88	1.2e-5	PFAM
Pfam:HEAT_2	101	170	3.9e-8	PFAM
Pfam:HEAT	102	130	1.2e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126802

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127899

Predicted Effect

probably benign
Transcript: ENSMUST00000131217

SMART Domains

Protein: ENSMUSP00000125667
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000136662

SMART Domains

Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
low complexity region	172	182	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147781

SMART Domains

Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148860

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd7	A	G	6: 18,866,722 (GRCm39)	S81G	probably benign	Het
Arel1	T	C	12: 84,973,078 (GRCm39)	K573R	possibly damaging	Het
Atf7ip	C	T	6: 136,583,808 (GRCm39)	R1280C	probably damaging	Het
Atp1a4	T	A	1: 172,058,718 (GRCm39)	D909V	probably damaging	Het
Cdh2	T	G	18: 16,760,622 (GRCm39)		probably null	Het
Col6a1	A	T	10: 76,559,339 (GRCm39)	I99N	probably damaging	Het
Dennd4c	A	G	4: 86,699,916 (GRCm39)	T256A	probably damaging	Het
Dync1h1	C	A	12: 110,624,560 (GRCm39)	T3700N	probably damaging	Het
Ereg	T	C	5: 91,237,970 (GRCm39)	V152A	probably damaging	Het
Gm4950	T	C	18: 51,998,641 (GRCm39)	T105A	probably benign	Het
Hsf2	T	C	10: 57,377,467 (GRCm39)	I121T	probably damaging	Het
Kmt2a	A	T	9: 44,759,764 (GRCm39)	L728Q	probably damaging	Het
Llgl1	G	T	11: 60,602,261 (GRCm39)	R768L	probably benign	Het
Lyst	A	G	13: 13,810,048 (GRCm39)	I573V	probably benign	Het
Macf1	G	T	4: 123,369,157 (GRCm39)	T303K	probably damaging	Het
Map3k5	A	T	10: 19,899,535 (GRCm39)	Q264L	possibly damaging	Het
Mboat1	T	C	13: 30,408,376 (GRCm39)	S180P	probably damaging	Het
Mfsd6	T	C	1: 52,700,183 (GRCm39)	D655G	probably damaging	Het
Myh2	A	G	11: 67,083,785 (GRCm39)	E1521G	possibly damaging	Het
Nsd2	T	A	5: 34,049,366 (GRCm39)	S1200R	probably damaging	Het
Or51k2	T	C	7: 103,595,808 (GRCm39)	F12L	probably damaging	Het
Or52n2b	T	C	7: 104,565,668 (GRCm39)	I278M	probably damaging	Het
Or6z3	G	A	7: 6,464,057 (GRCm39)	C183Y	probably damaging	Het
Or8h9	T	C	2: 86,789,449 (GRCm39)	M118V	possibly damaging	Het
Pbrm1	T	C	14: 30,796,784 (GRCm39)	I875T	probably damaging	Het
Pla2g1b	T	A	5: 115,608,885 (GRCm39)	F26I	probably damaging	Het
Plscr4	A	G	9: 92,366,814 (GRCm39)	N143D	possibly damaging	Het
Rab11fip1	G	T	8: 27,644,841 (GRCm39)	R315S	probably damaging	Het
Serac1	A	T	17: 6,119,657 (GRCm39)	V91D	probably benign	Het
Slco1a6	C	A	6: 142,091,431 (GRCm39)	G90C	probably damaging	Het
Sulf1	A	G	1: 12,867,134 (GRCm39)	Y106C	probably benign	Het
Syt13	G	A	2: 92,783,794 (GRCm39)	V355M	probably damaging	Het
Tjp1	G	A	7: 64,985,850 (GRCm39)	R314*	probably null	Het
Tshr	A	G	12: 91,504,961 (GRCm39)	D633G	probably damaging	Het
Usp5	C	G	6: 124,799,593 (GRCm39)	K318N	possibly damaging	Het
Znrf4	A	G	17: 56,818,701 (GRCm39)	F202S	probably damaging	Het
Zswim8	T	A	14: 20,763,533 (GRCm39)	W427R	probably damaging	Het

Other mutations in Rptor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Rptor	APN	11	119,690,271 (GRCm39)	missense	possibly damaging	0.92
IGL01319:Rptor	APN	11	119,781,996 (GRCm39)	missense	probably benign	0.01
IGL01375:Rptor	APN	11	119,787,262 (GRCm39)	missense	possibly damaging	0.68
IGL01899:Rptor	APN	11	119,748,279 (GRCm39)	missense	probably benign	0.04
IGL01927:Rptor	APN	11	119,548,500 (GRCm39)	missense	probably damaging	1.00
IGL02312:Rptor	APN	11	119,737,741 (GRCm39)	missense	possibly damaging	0.84
IGL02620:Rptor	APN	11	119,671,413 (GRCm39)	missense	probably benign	0.12
IGL02651:Rptor	APN	11	119,783,438 (GRCm39)	missense	possibly damaging	0.69
IGL03182:Rptor	APN	11	119,615,971 (GRCm39)	missense	probably damaging	1.00
Velocipede	UTSW	11	119,786,803 (GRCm39)	missense	possibly damaging	0.92
R0103:Rptor	UTSW	11	119,775,793 (GRCm39)	missense	probably benign	0.01
R0179:Rptor	UTSW	11	119,763,193 (GRCm39)	missense	probably benign	0.14
R0217:Rptor	UTSW	11	119,785,738 (GRCm39)	splice site	probably benign
R0219:Rptor	UTSW	11	119,712,603 (GRCm39)	intron	probably benign
R0324:Rptor	UTSW	11	119,783,467 (GRCm39)	missense	probably damaging	1.00
R0432:Rptor	UTSW	11	119,671,379 (GRCm39)	nonsense	probably null
R0718:Rptor	UTSW	11	119,763,202 (GRCm39)	missense	probably benign	0.15
R0730:Rptor	UTSW	11	119,775,780 (GRCm39)	missense	probably benign	0.06
R1019:Rptor	UTSW	11	119,734,569 (GRCm39)	missense	probably damaging	1.00
R1073:Rptor	UTSW	11	119,634,717 (GRCm39)	missense	possibly damaging	0.93
R1424:Rptor	UTSW	11	119,671,419 (GRCm39)	nonsense	probably null
R1579:Rptor	UTSW	11	119,786,827 (GRCm39)	missense	probably benign	0.00
R1766:Rptor	UTSW	11	119,615,887 (GRCm39)	missense	probably damaging	0.99
R1844:Rptor	UTSW	11	119,647,146 (GRCm39)	missense	probably damaging	1.00
R2180:Rptor	UTSW	11	119,615,970 (GRCm39)	missense	probably damaging	1.00
R2274:Rptor	UTSW	11	119,647,148 (GRCm39)	nonsense	probably null
R2275:Rptor	UTSW	11	119,647,148 (GRCm39)	nonsense	probably null
R2408:Rptor	UTSW	11	119,748,277 (GRCm39)	missense	probably damaging	0.99
R2981:Rptor	UTSW	11	119,756,420 (GRCm39)	missense	probably damaging	1.00
R2996:Rptor	UTSW	11	119,747,124 (GRCm39)	missense	probably damaging	1.00
R3001:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R3002:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R3003:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R4358:Rptor	UTSW	11	119,562,171 (GRCm39)	missense	probably damaging	0.98
R4592:Rptor	UTSW	11	119,689,666 (GRCm39)	missense	probably null	1.00
R4647:Rptor	UTSW	11	119,781,989 (GRCm39)	missense	probably benign	0.33
R4666:Rptor	UTSW	11	119,634,708 (GRCm39)	missense	probably damaging	1.00
R4974:Rptor	UTSW	11	119,712,466 (GRCm39)	intron	probably benign
R5073:Rptor	UTSW	11	119,787,305 (GRCm39)	missense	possibly damaging	0.71
R5199:Rptor	UTSW	11	119,494,642 (GRCm39)	missense	probably benign
R5216:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5219:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5277:Rptor	UTSW	11	119,713,782 (GRCm39)	missense	probably damaging	1.00
R5365:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5366:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5447:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5630:Rptor	UTSW	11	119,647,075 (GRCm39)	missense	probably benign	0.01
R6220:Rptor	UTSW	11	119,788,268 (GRCm39)	missense	possibly damaging	0.83
R6567:Rptor	UTSW	11	119,786,838 (GRCm39)	missense	probably benign	0.00
R6741:Rptor	UTSW	11	119,786,803 (GRCm39)	missense	possibly damaging	0.92
R6915:Rptor	UTSW	11	119,647,171 (GRCm39)	missense	probably damaging	0.99
R7032:Rptor	UTSW	11	119,737,762 (GRCm39)	missense	probably benign	0.00
R7051:Rptor	UTSW	11	119,765,012 (GRCm39)	utr 3 prime	probably benign
R7396:Rptor	UTSW	11	119,763,181 (GRCm39)	missense	probably benign	0.10
R7429:Rptor	UTSW	11	119,737,654 (GRCm39)	missense	probably damaging	1.00
R7430:Rptor	UTSW	11	119,737,654 (GRCm39)	missense	probably damaging	1.00
R7447:Rptor	UTSW	11	119,775,805 (GRCm39)	missense	probably benign	0.00
R7595:Rptor	UTSW	11	119,634,779 (GRCm39)	missense	possibly damaging	0.82
R7776:Rptor	UTSW	11	119,783,453 (GRCm39)	missense	probably benign	0.01
R7854:Rptor	UTSW	11	119,748,779 (GRCm39)	missense	probably benign	0.02
R8288:Rptor	UTSW	11	119,748,763 (GRCm39)	missense	probably benign	0.02
R8305:Rptor	UTSW	11	119,702,812 (GRCm39)	missense	probably damaging	1.00
R8328:Rptor	UTSW	11	119,783,473 (GRCm39)	missense	probably benign	0.00
R8351:Rptor	UTSW	11	119,783,465 (GRCm39)	missense	probably benign	0.22
R8772:Rptor	UTSW	11	119,615,858 (GRCm39)	missense	probably damaging	1.00
R8871:Rptor	UTSW	11	119,494,751 (GRCm39)	missense	probably benign	0.01
R8925:Rptor	UTSW	11	119,782,036 (GRCm39)	missense	probably benign	0.11
R8927:Rptor	UTSW	11	119,782,036 (GRCm39)	missense	probably benign	0.11
R8981:Rptor	UTSW	11	119,734,508 (GRCm39)	missense	possibly damaging	0.90
R9149:Rptor	UTSW	11	119,777,896 (GRCm39)	missense	probably benign	0.05
R9213:Rptor	UTSW	11	119,494,765 (GRCm39)	missense	probably benign
R9224:Rptor	UTSW	11	119,785,113 (GRCm39)	missense	probably benign	0.11
R9290:Rptor	UTSW	11	119,702,823 (GRCm39)	missense	probably benign	0.00
R9314:Rptor	UTSW	11	119,786,772 (GRCm39)	missense	probably benign	0.43
R9371:Rptor	UTSW	11	119,562,152 (GRCm39)	missense	possibly damaging	0.66
R9719:Rptor	UTSW	11	119,781,940 (GRCm39)	missense	probably benign	0.13
R9751:Rptor	UTSW	11	119,777,964 (GRCm39)	missense	probably benign	0.02
X0050:Rptor	UTSW	11	119,737,231 (GRCm39)	missense	probably benign	0.14
X0066:Rptor	UTSW	11	119,748,692 (GRCm39)	missense	probably benign	0.31
Z0001:Rptor	UTSW	11	119,762,318 (GRCm39)	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119,748,279 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,742,294 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,737,578 (GRCm39)	critical splice acceptor site	probably null
Z0001:Rptor	UTSW	11	119,690,145 (GRCm39)	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119,647,241 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,647,062 (GRCm39)	splice site	probably null
Z0001:Rptor	UTSW	11	119,494,798 (GRCm39)	critical splice donor site	probably null
Z0001:Rptor	UTSW	11	119,787,375 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,764,977 (GRCm39)	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAATATCCCTGTTGCCATGG -3'
(R):5'- ATTCTGGCTCAAGAACAGCTGG -3'

Sequencing Primer
(F):5'- TTGCCATGGCTGCAGACTC -3'
(R):5'- AGAACAGCTGGTCACTTGTC -3'

Posted On

2016-04-27