Incidental Mutation 'R4962:Piezo1'
ID381844
Institutional Source Beutler Lab
Gene Symbol Piezo1
Ensembl Gene ENSMUSG00000014444
Gene Namepiezo-type mechanosensitive ion channel component 1
SynonymsFam38a, Piezo1
MMRRC Submission 042559-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4962 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location122481698-122551329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122486481 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1848 (E1848K)
Ref Sequence ENSEMBL: ENSMUSP00000114584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000116412] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000136253] [ENSMUST00000151855] [ENSMUST00000156333]
Predicted Effect probably benign
Transcript: ENSMUST00000067252
AA Change: E1847K

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444
AA Change: E1847K

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116412
SMART Domains Protein: ENSMUSP00000112113
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 1e-3 SMART
Pfam:CTU2 347 470 2.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126553
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128383
SMART Domains Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
transmembrane domain 406 428 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 567 584 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 716 733 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
transmembrane domain 803 820 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
coiled coil region 895 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134304
Predicted Effect probably benign
Transcript: ENSMUST00000136253
Predicted Effect probably benign
Transcript: ENSMUST00000148497
SMART Domains Protein: ENSMUSP00000121725
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 505 522 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Pfam:PIEZO 580 809 3.2e-98 PFAM
low complexity region 826 837 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151855
SMART Domains Protein: ENSMUSP00000133622
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 9e-4 SMART
Pfam:DUF2392 277 377 1.7e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155803
Predicted Effect probably benign
Transcript: ENSMUST00000156333
AA Change: E1848K

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444
AA Change: E1848K

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212499
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik A G 2: 151,472,808 F317L possibly damaging Het
Abcc4 A G 14: 118,668,399 I85T probably benign Het
Acoxl G T 2: 128,075,890 C498F probably damaging Het
Akap13 C T 7: 75,749,430 T2752I probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ap2a2 T G 7: 141,630,148 F836C probably damaging Het
Atp2c1 A G 9: 105,442,950 V404A probably benign Het
Atp7b G T 8: 22,020,885 A415E probably damaging Het
Babam2 A T 5: 31,785,583 I71L possibly damaging Het
Bean1 A G 8: 104,216,974 T54A probably damaging Het
Cacna1b T A 2: 24,618,318 I1816F probably damaging Het
Cacna1b C T 2: 24,657,366 G1202D probably damaging Het
Casp8ap2 A G 4: 32,640,554 E536G probably damaging Het
Cfap57 A G 4: 118,613,065 V206A probably benign Het
Clca2 A T 3: 145,077,879 D658E probably damaging Het
Cwc22 A T 2: 77,896,309 S809T probably benign Het
Cyp2c54 C T 19: 40,072,141 R132Q possibly damaging Het
Ddx20 A T 3: 105,680,605 D386E possibly damaging Het
Ddx50 T C 10: 62,642,853 T185A probably damaging Het
Decr1 G A 4: 15,930,976 R119* probably null Het
Dennd4a T C 9: 64,906,003 S1415P probably benign Het
Dnah12 A T 14: 26,716,700 I495L probably benign Het
Dnah2 G A 11: 69,455,973 Q2596* probably null Het
Dnajb13 A G 7: 100,507,500 L123S probably benign Het
Elavl3 G A 9: 22,036,811 P19L probably benign Het
Fer1l6 T C 15: 58,571,401 S518P probably benign Het
Fgd3 T C 13: 49,266,629 S591G probably benign Het
Galnt18 C A 7: 111,472,064 R566L probably benign Het
Galnt6 A T 15: 100,696,574 Y525* probably null Het
Gm10036 A T 18: 15,833,302 Y170F probably benign Het
Hacd2 A G 16: 35,022,551 D24G unknown Het
Idh3a T C 9: 54,596,041 M128T possibly damaging Het
Ido1 C T 8: 24,584,549 M359I probably benign Het
Ikbkb T C 8: 22,681,677 T185A probably damaging Het
Insl6 C T 19: 29,321,619 G131D probably damaging Het
Irgm1 A C 11: 48,866,332 S217R possibly damaging Het
Itga11 T A 9: 62,761,568 Y702* probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Kansl2 T C 15: 98,531,843 M103V probably benign Het
Kcnq2 T C 2: 181,112,043 N258S possibly damaging Het
Kdm5d A T Y: 940,624 D1045V probably damaging Het
Lats2 A G 14: 57,699,592 L480P probably damaging Het
Lin28b T A 10: 45,420,640 K87N possibly damaging Het
Lpgat1 T A 1: 191,719,570 W103R probably damaging Het
Lpl G T 8: 68,894,693 G166C probably damaging Het
Ly75 A T 2: 60,352,125 Y569N probably damaging Het
Mcm8 A T 2: 132,838,769 E564D probably damaging Het
Me2 G T 18: 73,785,776 N411K probably damaging Het
Mn1 A G 5: 111,454,786 T1297A possibly damaging Het
Mphosph8 T A 14: 56,678,589 F447L probably benign Het
Nacad T A 11: 6,599,169 D1294V probably damaging Het
Neu3 A T 7: 99,823,408 F41I probably damaging Het
Nlrp6 G T 7: 140,923,584 L534F probably damaging Het
Nrap A G 19: 56,378,143 M338T probably damaging Het
Nuak1 T C 10: 84,375,115 K370E probably damaging Het
Olfr1151 A G 2: 87,857,288 T38A probably benign Het
Olfr1425 T A 19: 12,074,275 D119V probably damaging Het
Olfr479 T A 7: 108,055,440 C153S probably benign Het
Olfr805 C T 10: 129,722,723 V274M probably damaging Het
P3h3 T C 6: 124,841,773 S701G probably benign Het
Pdss2 T C 10: 43,298,912 M138T possibly damaging Het
Prmt3 T G 7: 49,826,809 S389A probably benign Het
Prrxl1 G T 14: 32,647,144 probably benign Het
Prune2 T A 19: 17,122,273 F1714I probably benign Het
Ptgis A G 2: 167,225,274 probably null Het
Ptpn20 T C 14: 33,614,459 V85A probably benign Het
Rabepk A T 2: 34,780,657 Y264N probably damaging Het
Ralgapa2 A T 2: 146,434,834 C495* probably null Het
Satb2 A G 1: 56,891,168 I232T probably benign Het
Selenbp2 A T 3: 94,703,549 L307F probably damaging Het
Sgpl1 T G 10: 61,114,084 Y112S probably damaging Het
Slitrk5 T C 14: 111,681,247 S768P probably benign Het
Smc3 T A 19: 53,631,517 Y615N probably damaging Het
Spag17 A G 3: 100,027,623 N715S probably benign Het
Spats2 A G 15: 99,212,276 E518G probably benign Het
Spats2l A G 1: 57,885,824 H127R possibly damaging Het
Tenm3 T A 8: 48,278,961 K1287* probably null Het
Thoc1 T A 18: 9,962,387 S91T probably benign Het
Thoc6 C T 17: 23,669,937 G166S probably damaging Het
Tmem107 C A 11: 69,071,261 T42N possibly damaging Het
Tmprss11c A G 5: 86,237,710 I288T probably damaging Het
Tnrc18 A G 5: 142,739,493 F1827S unknown Het
Trmt112 C A 19: 6,910,198 T5N probably damaging Het
Trp53bp1 A T 2: 121,270,546 M57K probably benign Het
Ttbk2 C A 2: 120,745,150 Q1115H probably damaging Het
Ttn C A 2: 76,729,645 E27725* probably null Het
Ttn A G 2: 76,944,109 M2151T probably damaging Het
Usp9y A T Y: 1,384,336 D727E probably damaging Het
Vps13c A G 9: 67,873,891 T221A probably damaging Het
Zbtb20 A G 16: 43,618,692 D725G probably damaging Het
Zfp341 A T 2: 154,626,814 I126F possibly damaging Het
Zfyve16 C T 13: 92,513,894 A861T probably damaging Het
Other mutations in Piezo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Piezo1 APN 8 122497870 missense possibly damaging 0.91
IGL01094:Piezo1 APN 8 122482138 missense probably damaging 0.99
IGL01321:Piezo1 APN 8 122487600 missense probably damaging 0.99
IGL01695:Piezo1 APN 8 122495509 missense possibly damaging 0.81
IGL01762:Piezo1 APN 8 122487929 nonsense probably null
IGL01922:Piezo1 APN 8 122492692 missense probably benign 0.41
IGL01953:Piezo1 APN 8 122491184 missense probably damaging 1.00
IGL01997:Piezo1 APN 8 122488331 splice site probably benign
IGL02381:Piezo1 APN 8 122498544 missense probably benign 0.28
IGL02398:Piezo1 APN 8 122486563 missense probably benign 0.21
IGL02562:Piezo1 APN 8 122496763 missense probably benign 0.11
IGL02572:Piezo1 APN 8 122485305 missense probably benign 0.28
IGL02691:Piezo1 APN 8 122501949 missense possibly damaging 0.58
IGL02726:Piezo1 APN 8 122487155 missense probably damaging 0.99
IGL02814:Piezo1 APN 8 122498215 missense probably damaging 1.00
IGL02931:Piezo1 APN 8 122483519 missense probably damaging 1.00
IGL03145:Piezo1 APN 8 122482921 missense probably benign 0.14
FR4449:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4548:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4737:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4976:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
LCD18:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
R0085:Piezo1 UTSW 8 122501615 missense probably damaging 0.98
R0096:Piezo1 UTSW 8 122485370 unclassified probably benign
R0970:Piezo1 UTSW 8 122486810 missense possibly damaging 0.94
R1364:Piezo1 UTSW 8 122498571 missense possibly damaging 0.61
R1460:Piezo1 UTSW 8 122502151 missense possibly damaging 0.86
R1485:Piezo1 UTSW 8 122482049 missense probably damaging 1.00
R1538:Piezo1 UTSW 8 122491403 missense probably damaging 1.00
R1655:Piezo1 UTSW 8 122496822 missense probably benign 0.09
R1700:Piezo1 UTSW 8 122487502 missense probably damaging 1.00
R1860:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1861:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1899:Piezo1 UTSW 8 122482645 unclassified probably benign
R1899:Piezo1 UTSW 8 122489566 missense probably damaging 1.00
R1900:Piezo1 UTSW 8 122482645 unclassified probably benign
R2018:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2019:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2219:Piezo1 UTSW 8 122491488 missense probably benign 0.01
R2331:Piezo1 UTSW 8 122487266 unclassified probably null
R3016:Piezo1 UTSW 8 122506027 critical splice donor site probably null
R3699:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3700:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3746:Piezo1 UTSW 8 122492638 missense probably damaging 1.00
R3905:Piezo1 UTSW 8 122482143 missense probably damaging 1.00
R4093:Piezo1 UTSW 8 122501160 critical splice donor site probably null
R4296:Piezo1 UTSW 8 122491127 missense probably damaging 1.00
R4396:Piezo1 UTSW 8 122498674 missense probably damaging 0.98
R4467:Piezo1 UTSW 8 122486396 missense probably benign 0.17
R4614:Piezo1 UTSW 8 122486411 missense probably benign 0.25
R4642:Piezo1 UTSW 8 122495454 missense probably damaging 1.00
R4688:Piezo1 UTSW 8 122488539 missense probably damaging 1.00
R4734:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4749:Piezo1 UTSW 8 122486939 missense possibly damaging 0.48
R4749:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4865:Piezo1 UTSW 8 122486921 missense probably damaging 1.00
R4869:Piezo1 UTSW 8 122487545 missense probably benign
R5026:Piezo1 UTSW 8 122486818 missense probably benign 0.11
R5418:Piezo1 UTSW 8 122486780 missense probably damaging 1.00
R5625:Piezo1 UTSW 8 122482960 missense probably benign 0.01
R5759:Piezo1 UTSW 8 122507655 missense probably damaging 0.98
R5864:Piezo1 UTSW 8 122486373 missense possibly damaging 0.75
R5898:Piezo1 UTSW 8 122487943 missense probably benign 0.00
R5948:Piezo1 UTSW 8 122483347 missense probably benign 0.01
R6052:Piezo1 UTSW 8 122506269 missense probably damaging 1.00
R6086:Piezo1 UTSW 8 122501657 missense possibly damaging 0.73
R6216:Piezo1 UTSW 8 122489130 missense probably benign 0.05
R6271:Piezo1 UTSW 8 122494932 missense probably damaging 1.00
R6549:Piezo1 UTSW 8 122500263 missense probably benign 0.02
R6723:Piezo1 UTSW 8 122507627 missense probably benign 0.15
R6871:Piezo1 UTSW 8 122485027 unclassified probably null
R6919:Piezo1 UTSW 8 122490281 missense probably damaging 1.00
R7085:Piezo1 UTSW 8 122490894 missense
R7105:Piezo1 UTSW 8 122482118 missense unknown
R7267:Piezo1 UTSW 8 122497529 missense
Predicted Primers PCR Primer
(F):5'- AACATGGCAGGGGTCTAGTCTG -3'
(R):5'- GGTCTAAGCATGACCTGACCTG -3'

Sequencing Primer
(F):5'- GGTCTAGTCTGGGCTCTCAC -3'
(R):5'- TGGGTCAGGCTCCTCAC -3'
Posted On2016-04-27