Incidental Mutation 'R7105:Piezo1'
ID551117
Institutional Source Beutler Lab
Gene Symbol Piezo1
Ensembl Gene ENSMUSG00000014444
Gene Namepiezo-type mechanosensitive ion channel component 1
SynonymsFam38a, Piezo1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7105 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location122481698-122551329 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122482118 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 2503 (I2503T)
Ref Sequence ENSEMBL: ENSMUSP00000114584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000116412] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000134127] [ENSMUST00000136253] [ENSMUST00000146634] [ENSMUST00000151855] [ENSMUST00000156333]
Predicted Effect probably damaging
Transcript: ENSMUST00000067252
AA Change: I2502T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444
AA Change: I2502T

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116412
SMART Domains Protein: ENSMUSP00000112113
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 1e-3 SMART
Pfam:CTU2 347 470 2.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128383
SMART Domains Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
transmembrane domain 406 428 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 567 584 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 716 733 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
transmembrane domain 803 820 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
coiled coil region 895 926 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134127
SMART Domains Protein: ENSMUSP00000119237
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
SCOP:d1sur__ 25 128 4e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136253
Predicted Effect probably benign
Transcript: ENSMUST00000146634
SMART Domains Protein: ENSMUSP00000119931
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 78 87 N/A INTRINSIC
low complexity region 96 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148497
SMART Domains Protein: ENSMUSP00000121725
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 505 522 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Pfam:PIEZO 580 809 3.2e-98 PFAM
low complexity region 826 837 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151855
SMART Domains Protein: ENSMUSP00000133622
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 9e-4 SMART
Pfam:DUF2392 277 377 1.7e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156333
AA Change: I2503T
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444
AA Change: I2503T

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212499
Meta Mutation Damage Score 0.452 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (65/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mechanically-activated ion channel that links mechanical forces to biological signals. The encoded protein contains 36 transmembrane domains and functions as a homotetramer. Defects in this gene have been associated with dehydrated hereditary stomatocytosis. [provided by RefSeq, Jul 2015]
PHENOTYPE: Most mice homozygous for a gene trapped allele die at midgestation, exhibiting embryonic growth retardation, pericardial effusion, and vascular remodeling defects in the yolk sac and the embryo proper. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,397,842 I3565N probably damaging Het
Adam8 T C 7: 139,990,055 E99G probably benign Het
Adnp2 A C 18: 80,128,151 H1014Q possibly damaging Het
Agbl4 T A 4: 111,566,723 N315K probably benign Het
Ankrd33b G T 15: 31,305,068 N183K probably damaging Het
Arhgef39 A G 4: 43,498,913 S113P possibly damaging Het
Bdp1 G A 13: 100,070,181 P618S probably damaging Het
Bhlhe40 C T 6: 108,665,036 P314S possibly damaging Het
Birc2 A C 9: 7,819,441 I490S probably damaging Het
Blm T C 7: 80,499,768 I698V probably benign Het
C4b G A 17: 34,730,911 T1433M possibly damaging Het
C87499 G A 4: 88,630,102 S22F probably damaging Het
Car12 A G 9: 66,752,406 T238A probably damaging Het
Cend1 G A 7: 141,427,652 P85L probably benign Het
Cftr A T 6: 18,318,972 D1337V probably damaging Het
Chsy3 T A 18: 59,176,419 M248K probably damaging Het
Chtf8 A G 8: 106,885,251 F352S probably damaging Het
Csf2ra T C 19: 61,225,020 D384G possibly damaging Het
Ctnnbip1 T C 4: 149,546,480 S59P probably benign Het
Cyth3 A G 5: 143,707,272 N312D probably benign Het
Dtnb T C 12: 3,648,391 probably null Het
Duox2 A G 2: 122,289,552 S826P possibly damaging Het
Enthd1 C T 15: 80,509,209 A273T probably benign Het
Gm13084 T C 4: 143,810,771 N330S probably benign Het
Gm3138 T C 14: 4,252,479 V159A possibly damaging Het
Hhip T C 8: 79,975,009 D632G probably benign Het
Igfn1 A T 1: 135,984,218 C114S probably benign Het
Islr2 T C 9: 58,197,814 D765G probably damaging Het
Klf14 TCCCC TCCC 6: 30,958,541 probably null Het
Mapk12 G A 15: 89,131,158 P362L probably benign Het
Msi1 T G 5: 115,433,870 F96V probably damaging Het
Mthfd1l T C 10: 4,103,261 V870A probably benign Het
Nfat5 T C 8: 107,369,191 S1355P possibly damaging Het
Olfr1018 G T 2: 85,823,880 R303M probably benign Het
Oplah T C 15: 76,297,687 N1079D probably damaging Het
Osbpl1a T A 18: 12,766,963 I645F probably benign Het
Pank4 T C 4: 154,980,167 S728P probably benign Het
Parp2 TTGCCATAAGTGCTAAATGAAGCC T 14: 50,810,064 probably null Het
Plekhg6 A G 6: 125,378,805 L12P probably damaging Het
Plekhs1 T A 19: 56,477,215 F204Y probably damaging Het
Prep T A 10: 45,126,063 I438N probably benign Het
Prss58 T C 6: 40,897,766 H47R probably damaging Het
Rad51ap2 T G 12: 11,458,277 D733E possibly damaging Het
Robo1 A T 16: 72,742,161 I31F probably damaging Het
Setd2 A G 9: 110,548,260 Y381C probably damaging Het
Slc47a2 A G 11: 61,342,443 V87A probably benign Het
Slc5a9 T C 4: 111,898,695 N2S probably benign Het
Spata13 A G 14: 60,753,870 D1024G probably damaging Het
Stat1 T G 1: 52,151,249 N554K probably benign Het
Suclg2 T C 6: 95,595,654 D110G possibly damaging Het
Sult1c1 T A 17: 53,973,889 probably null Het
Taf5l A G 8: 124,003,212 I246T probably damaging Het
Tcof1 A T 18: 60,843,296 D80E probably damaging Het
Tex33 T A 15: 78,386,118 D150V possibly damaging Het
Tmem233 T C 5: 116,082,998 Y63C probably damaging Het
Tshz3 A G 7: 36,769,756 E390G probably damaging Het
Ttn T C 2: 76,730,266 T29264A possibly damaging Het
Ubr5 T C 15: 38,008,775 T1065A Het
Vcp A G 4: 42,985,991 V341A probably damaging Het
Vmn1r176 A T 7: 23,835,323 L135* probably null Het
Vmn1r57 T A 7: 5,220,500 I8N probably damaging Het
Ythdc2 C T 18: 44,834,563 P209S probably damaging Het
Zfp213 A T 17: 23,558,204 V288D probably benign Het
Zfp362 T C 4: 128,774,526 I418V probably damaging Het
Zfp707 C A 15: 75,974,746 T215K Het
Zfp957 G C 14: 79,212,962 R466G probably benign Het
Other mutations in Piezo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Piezo1 APN 8 122497870 missense possibly damaging 0.91
IGL01094:Piezo1 APN 8 122482138 missense probably damaging 0.99
IGL01321:Piezo1 APN 8 122487600 missense probably damaging 0.99
IGL01695:Piezo1 APN 8 122495509 missense possibly damaging 0.81
IGL01762:Piezo1 APN 8 122487929 nonsense probably null
IGL01922:Piezo1 APN 8 122492692 missense probably benign 0.41
IGL01953:Piezo1 APN 8 122491184 missense probably damaging 1.00
IGL01997:Piezo1 APN 8 122488331 splice site probably benign
IGL02381:Piezo1 APN 8 122498544 missense probably benign 0.28
IGL02398:Piezo1 APN 8 122486563 missense probably benign 0.21
IGL02562:Piezo1 APN 8 122496763 missense probably benign 0.11
IGL02572:Piezo1 APN 8 122485305 missense probably benign 0.28
IGL02691:Piezo1 APN 8 122501949 missense possibly damaging 0.58
IGL02726:Piezo1 APN 8 122487155 missense probably damaging 0.99
IGL02814:Piezo1 APN 8 122498215 missense probably damaging 1.00
IGL02931:Piezo1 APN 8 122483519 missense probably damaging 1.00
IGL03145:Piezo1 APN 8 122482921 missense probably benign 0.14
FR4449:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4548:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4737:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
FR4976:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
LCD18:Piezo1 UTSW 8 122495569 missense probably damaging 1.00
R0085:Piezo1 UTSW 8 122501615 missense probably damaging 0.98
R0096:Piezo1 UTSW 8 122485370 unclassified probably benign
R0970:Piezo1 UTSW 8 122486810 missense possibly damaging 0.94
R1364:Piezo1 UTSW 8 122498571 missense possibly damaging 0.61
R1460:Piezo1 UTSW 8 122502151 missense possibly damaging 0.86
R1485:Piezo1 UTSW 8 122482049 missense probably damaging 1.00
R1538:Piezo1 UTSW 8 122491403 missense probably damaging 1.00
R1655:Piezo1 UTSW 8 122496822 missense probably benign 0.09
R1700:Piezo1 UTSW 8 122487502 missense probably damaging 1.00
R1860:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1861:Piezo1 UTSW 8 122495750 missense possibly damaging 0.90
R1899:Piezo1 UTSW 8 122482645 unclassified probably benign
R1899:Piezo1 UTSW 8 122489566 missense probably damaging 1.00
R1900:Piezo1 UTSW 8 122482645 unclassified probably benign
R2018:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2019:Piezo1 UTSW 8 122482712 missense probably benign 0.43
R2219:Piezo1 UTSW 8 122491488 missense probably benign 0.01
R2331:Piezo1 UTSW 8 122487266 unclassified probably null
R3016:Piezo1 UTSW 8 122506027 critical splice donor site probably null
R3699:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3700:Piezo1 UTSW 8 122494903 missense probably damaging 1.00
R3746:Piezo1 UTSW 8 122492638 missense probably damaging 1.00
R3905:Piezo1 UTSW 8 122482143 missense probably damaging 1.00
R4093:Piezo1 UTSW 8 122501160 critical splice donor site probably null
R4296:Piezo1 UTSW 8 122491127 missense probably damaging 1.00
R4396:Piezo1 UTSW 8 122498674 missense probably damaging 0.98
R4467:Piezo1 UTSW 8 122486396 missense probably benign 0.17
R4614:Piezo1 UTSW 8 122486411 missense probably benign 0.25
R4642:Piezo1 UTSW 8 122495454 missense probably damaging 1.00
R4688:Piezo1 UTSW 8 122488539 missense probably damaging 1.00
R4734:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4749:Piezo1 UTSW 8 122486939 missense possibly damaging 0.48
R4749:Piezo1 UTSW 8 122498206 missense probably damaging 1.00
R4865:Piezo1 UTSW 8 122486921 missense probably damaging 1.00
R4869:Piezo1 UTSW 8 122487545 missense probably benign
R4962:Piezo1 UTSW 8 122486481 missense probably benign 0.41
R5026:Piezo1 UTSW 8 122486818 missense probably benign 0.11
R5418:Piezo1 UTSW 8 122486780 missense probably damaging 1.00
R5625:Piezo1 UTSW 8 122482960 missense probably benign 0.01
R5759:Piezo1 UTSW 8 122507655 missense probably damaging 0.98
R5864:Piezo1 UTSW 8 122486373 missense possibly damaging 0.75
R5898:Piezo1 UTSW 8 122487943 missense probably benign 0.00
R5948:Piezo1 UTSW 8 122483347 missense probably benign 0.01
R6052:Piezo1 UTSW 8 122506269 missense probably damaging 1.00
R6086:Piezo1 UTSW 8 122501657 missense possibly damaging 0.73
R6216:Piezo1 UTSW 8 122489130 missense probably benign 0.05
R6271:Piezo1 UTSW 8 122494932 missense probably damaging 1.00
R6549:Piezo1 UTSW 8 122500263 missense probably benign 0.02
R6723:Piezo1 UTSW 8 122507627 missense probably benign 0.15
R6871:Piezo1 UTSW 8 122485027 unclassified probably null
R6919:Piezo1 UTSW 8 122490281 missense probably damaging 1.00
R7085:Piezo1 UTSW 8 122490894 missense
R7267:Piezo1 UTSW 8 122497529 missense
Predicted Primers PCR Primer
(F):5'- GCATCATCAGGGCTTACGTAG -3'
(R):5'- TGAGTACTGCAGAGGGATCTC -3'

Sequencing Primer
(F):5'- TTACGTAGGCCAGGACCTGTC -3'
(R):5'- TACTGCAGAGGGATCTCCGAGAG -3'
Posted On2019-05-15