Incidental Mutation 'R0432:Zfp82'
ID38829
Institutional Source Beutler Lab
Gene Symbol Zfp82
Ensembl Gene ENSMUSG00000098022
Gene Namezinc finger protein 82
SynonymsKRAB16
MMRRC Submission 038634-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R0432 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location30054489-30072900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30056329 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 443 (E443K)
Ref Sequence ENSEMBL: ENSMUSP00000138217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080834] [ENSMUST00000182546] [ENSMUST00000182746] [ENSMUST00000182919] [ENSMUST00000183115] [ENSMUST00000183190] [ENSMUST00000207072] [ENSMUST00000207873]
Predicted Effect probably damaging
Transcript: ENSMUST00000080834
AA Change: E473K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079647
Gene: ENSMUSG00000098022
AA Change: E473K

DomainStartEndE-ValueType
KRAB 6 66 8.68e-33 SMART
ZnF_C2H2 168 190 1.1e-2 SMART
ZnF_C2H2 196 218 1.69e-3 SMART
ZnF_C2H2 224 246 1.79e-2 SMART
ZnF_C2H2 252 274 4.24e-4 SMART
ZnF_C2H2 280 300 5.2e0 SMART
ZnF_C2H2 308 330 7.05e-1 SMART
ZnF_C2H2 336 358 1.2e-3 SMART
ZnF_C2H2 364 386 3.63e-3 SMART
ZnF_C2H2 392 414 4.47e-3 SMART
ZnF_C2H2 420 442 1.79e-2 SMART
ZnF_C2H2 448 470 5.5e-3 SMART
ZnF_C2H2 476 498 5.9e-3 SMART
ZnF_C2H2 504 526 1.92e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182483
Predicted Effect probably damaging
Transcript: ENSMUST00000182546
AA Change: E443K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138217
Gene: ENSMUSG00000098022
AA Change: E443K

DomainStartEndE-ValueType
KRAB 6 62 5.01e-15 SMART
ZnF_C2H2 138 160 1.1e-2 SMART
ZnF_C2H2 166 188 1.69e-3 SMART
ZnF_C2H2 194 216 1.79e-2 SMART
ZnF_C2H2 222 244 4.24e-4 SMART
ZnF_C2H2 250 270 5.2e0 SMART
ZnF_C2H2 278 300 7.05e-1 SMART
ZnF_C2H2 306 328 1.2e-3 SMART
ZnF_C2H2 334 356 3.63e-3 SMART
ZnF_C2H2 362 384 4.47e-3 SMART
ZnF_C2H2 390 412 1.79e-2 SMART
ZnF_C2H2 418 440 5.5e-3 SMART
ZnF_C2H2 446 468 5.9e-3 SMART
ZnF_C2H2 474 496 1.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182746
SMART Domains Protein: ENSMUSP00000138567
Gene: ENSMUSG00000058447

DomainStartEndE-ValueType
KRAB 6 56 1.44e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182919
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183025
Predicted Effect probably benign
Transcript: ENSMUST00000183115
Predicted Effect probably benign
Transcript: ENSMUST00000183190
SMART Domains Protein: ENSMUSP00000138469
Gene: ENSMUSG00000098022

DomainStartEndE-ValueType
KRAB 6 66 8.68e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207072
Predicted Effect probably benign
Transcript: ENSMUST00000207873
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.9%
Validation Efficiency 99% (91/92)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik A G 17: 35,895,816 L110P probably damaging Het
4930522L14Rik A T 5: 109,736,919 C358S probably damaging Het
9330182L06Rik G T 5: 9,440,966 G659* probably null Het
Abca8b C A 11: 109,980,015 V104F possibly damaging Het
Afap1l2 T C 19: 56,917,119 probably benign Het
Ahctf1 A C 1: 179,784,161 I548R probably damaging Het
Alox12b G T 11: 69,169,556 G646V probably damaging Het
Aoah C T 13: 20,911,198 probably benign Het
Arhgap39 C T 15: 76,734,886 D833N probably damaging Het
Atxn1l A G 8: 109,731,693 W646R probably damaging Het
Cabp2 T C 19: 4,084,903 I28T possibly damaging Het
Cacna1b G A 2: 24,687,704 T719I probably damaging Het
Camk1d A T 2: 5,445,135 H70Q probably damaging Het
Car1 T C 3: 14,770,176 T170A probably benign Het
Ccdc162 T C 10: 41,541,860 T2113A probably benign Het
Cdc5l G A 17: 45,415,684 R321W probably damaging Het
Cdh17 T A 4: 11,771,273 C18* probably null Het
Cdk17 A T 10: 93,237,790 probably benign Het
Chd9 T A 8: 90,994,450 probably benign Het
Chrm5 T A 2: 112,479,655 K372M possibly damaging Het
Clasp2 A G 9: 113,909,419 T423A probably benign Het
Col11a1 A G 3: 114,205,901 probably benign Het
Col27a1 T C 4: 63,225,611 M512T possibly damaging Het
Dclk3 A G 9: 111,484,935 D693G probably damaging Het
Dcun1d3 T A 7: 119,857,950 K180* probably null Het
Dmxl2 T C 9: 54,416,951 R876G probably benign Het
Dnmbp A T 19: 43,854,857 Y432* probably null Het
Eml2 C T 7: 19,179,531 Q125* probably null Het
Faap100 A C 11: 120,373,876 probably benign Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gda A G 19: 21,417,107 Y129H probably damaging Het
Gga3 G A 11: 115,590,524 R207C probably damaging Het
Glg1 T C 8: 111,182,569 I496M probably damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gm10322 A T 10: 59,616,208 H49L possibly damaging Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Gramd3 G A 18: 56,474,069 C85Y probably benign Het
Grhl1 C T 12: 24,582,919 P153L probably benign Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hdlbp T C 1: 93,425,332 I414V probably damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Itsn1 T A 16: 91,815,520 Y266N probably damaging Het
Lipe G A 7: 25,398,488 P10L probably benign Het
Lrrc8a A G 2: 30,257,067 E631G probably damaging Het
Lvrn T A 18: 46,905,299 N973K possibly damaging Het
Man2c1 T A 9: 57,135,597 H250Q probably damaging Het
Mup3 T C 4: 62,085,282 T117A probably benign Het
Myo6 A C 9: 80,273,974 probably benign Het
Nbn T A 4: 15,983,951 probably benign Het
Ncapg T A 5: 45,672,428 N157K probably damaging Het
Olfr1024 T A 2: 85,904,157 N299I probably damaging Het
Olfr1137 G A 2: 87,711,430 H159Y probably benign Het
Olfr1154 T C 2: 87,902,960 T239A probably damaging Het
Olfr1178 C T 2: 88,392,033 T262I probably damaging Het
Olfr1434 T A 19: 12,283,903 M285K probably damaging Het
P4ha1 T A 10: 59,348,257 Y180* probably null Het
Pcdhb19 T A 18: 37,499,535 F794L probably benign Het
Pdxdc1 T A 16: 13,854,400 I379F probably damaging Het
Psme3 T A 11: 101,320,442 S185T possibly damaging Het
Ptgr1 A G 4: 58,978,045 S116P probably damaging Het
Ptpn23 A T 9: 110,389,010 probably null Het
Rabgap1l A C 1: 160,722,205 I277R probably benign Het
Rapgef1 C T 2: 29,679,816 T93I possibly damaging Het
Rbp3 A T 14: 33,954,773 D226V probably damaging Het
Rnf144a A T 12: 26,339,329 C38S probably damaging Het
Rptor C T 11: 119,780,553 Q281* probably null Het
Rragd T C 4: 33,004,332 L208S probably damaging Het
Slc12a4 T C 8: 105,959,488 E41G probably damaging Het
Slc16a1 G T 3: 104,653,419 V347F probably benign Het
Slit1 G A 19: 41,743,293 T39I probably damaging Het
Sra1 T C 18: 36,677,503 N98S probably benign Het
Ssx2ip T C 3: 146,426,429 L215P probably damaging Het
Syne2 A T 12: 75,949,064 H2126L probably damaging Het
Tep1 TTTCTTCTTCTT TTTCTTCTT 14: 50,866,823 probably benign Het
Tgfbi T C 13: 56,632,191 probably benign Het
Tmem232 T C 17: 65,256,503 M632V probably damaging Het
Tmem81 C G 1: 132,507,829 I124M probably damaging Het
Tnnt3 T G 7: 142,512,086 D153E probably benign Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Tpsab1 A G 17: 25,343,824 probably benign Het
Usp34 T A 11: 23,401,505 V1431D probably damaging Het
Wdr49 G T 3: 75,450,022 R285S possibly damaging Het
Wdr7 A G 18: 63,796,249 Y1052C probably damaging Het
Zan A T 5: 137,382,316 probably benign Het
Zfp652 G A 11: 95,763,739 V323I possibly damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp874b A G 13: 67,481,836 S10P probably damaging Het
Zmynd19 A G 2: 24,958,122 Y110C probably benign Het
Other mutations in Zfp82
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Zfp82 APN 7 30066330 missense probably damaging 1.00
IGL03030:Zfp82 APN 7 30057465 missense probably benign 0.00
PIT4142001:Zfp82 UTSW 7 30057276 missense probably damaging 1.00
R0513:Zfp82 UTSW 7 30056840 missense probably damaging 1.00
R0659:Zfp82 UTSW 7 30056329 missense probably damaging 1.00
R0959:Zfp82 UTSW 7 30056451 missense probably damaging 1.00
R1510:Zfp82 UTSW 7 30056622 missense probably damaging 1.00
R1697:Zfp82 UTSW 7 30057354 missense probably benign
R2198:Zfp82 UTSW 7 30057511 missense probably benign
R2892:Zfp82 UTSW 7 30056439 missense probably damaging 1.00
R4274:Zfp82 UTSW 7 30056367 missense probably damaging 0.99
R4932:Zfp82 UTSW 7 30056887 unclassified probably null
R5377:Zfp82 UTSW 7 30057166 missense probably damaging 1.00
R5677:Zfp82 UTSW 7 30057124 missense probably benign 0.43
R6822:Zfp82 UTSW 7 30056287 missense probably damaging 1.00
R7146:Zfp82 UTSW 7 30056167 missense probably benign
R7163:Zfp82 UTSW 7 30062244 missense probably benign
R7450:Zfp82 UTSW 7 30056895 missense probably damaging 1.00
R7476:Zfp82 UTSW 7 30056172 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GGAGACGGCTAAGACTTTGTCACAC -3'
(R):5'- CCTCACTCGCCATCAGAAGCTTAATG -3'

Sequencing Primer
(F):5'- GTCACACTTTGACAGTATGAACC -3'
(R):5'- cttatttcgcatcagagcatcc -3'
Posted On2013-05-23