Incidental Mutation 'R5070:Skint5'
ID388629
Institutional Source Beutler Lab
Gene Symbol Skint5
Ensembl Gene ENSMUSG00000078598
Gene Nameselection and upkeep of intraepithelial T cells 5
SynonymsOTTMUSG00000008560
MMRRC Submission 042660-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R5070 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location113477891-113999503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113795538 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 630 (I630F)
Ref Sequence ENSEMBL: ENSMUSP00000129582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169631] [ENSMUST00000170105]
Predicted Effect unknown
Transcript: ENSMUST00000169631
AA Change: I630F
SMART Domains Protein: ENSMUSP00000132470
Gene: ENSMUSG00000078598
AA Change: I630F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Blast:IG_like 173 249 2e-16 BLAST
internal_repeat_2 282 614 9.14e-29 PROSPERO
internal_repeat_1 284 770 2.19e-39 PROSPERO
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1294 2.19e-39 PROSPERO
internal_repeat_2 995 1306 9.14e-29 PROSPERO
transmembrane domain 1322 1341 N/A INTRINSIC
transmembrane domain 1361 1383 N/A INTRINSIC
transmembrane domain 1398 1420 N/A INTRINSIC
transmembrane domain 1441 1463 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000170105
AA Change: I630F
SMART Domains Protein: ENSMUSP00000129582
Gene: ENSMUSG00000078598
AA Change: I630F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
IGv 58 139 2.48e-8 SMART
Pfam:C2-set_2 162 238 3.9e-6 PFAM
internal_repeat_3 276 364 2.13e-10 PROSPERO
internal_repeat_2 282 593 3.81e-24 PROSPERO
internal_repeat_1 284 749 6.25e-39 PROSPERO
low complexity region 751 760 N/A INTRINSIC
low complexity region 772 781 N/A INTRINSIC
internal_repeat_1 808 1273 6.25e-39 PROSPERO
internal_repeat_2 995 1285 3.81e-24 PROSPERO
internal_repeat_3 1196 1287 2.13e-10 PROSPERO
transmembrane domain 1301 1320 N/A INTRINSIC
transmembrane domain 1340 1362 N/A INTRINSIC
transmembrane domain 1377 1399 N/A INTRINSIC
transmembrane domain 1420 1442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik G T 15: 84,420,163 A14E possibly damaging Het
3425401B19Rik A G 14: 32,661,792 S739P possibly damaging Het
Acacb T C 5: 114,246,028 I2206T possibly damaging Het
Actn2 A G 13: 12,288,522 I464T possibly damaging Het
AI987944 C T 7: 41,375,324 G77D probably benign Het
Ankar T C 1: 72,680,210 probably null Het
Armc9 A T 1: 86,257,237 H670L probably benign Het
Arvcf A G 16: 18,398,986 Y412C probably damaging Het
Baiap3 A T 17: 25,249,108 C283S probably damaging Het
Bend3 A T 10: 43,493,685 E11D probably damaging Het
Birc6 C T 17: 74,565,972 R409C probably damaging Het
Cds2 T A 2: 132,302,088 Y4* probably null Het
Celsr1 G T 15: 85,939,134 P1691Q possibly damaging Het
Chmp1a A T 8: 123,206,315 V133E probably benign Het
Cnbd2 T C 2: 156,335,398 V92A probably damaging Het
Comp G A 8: 70,376,495 G272S probably benign Het
Csnk1a1 T A 18: 61,555,781 F11I probably benign Het
Ctse A G 1: 131,668,179 D203G probably damaging Het
Cyp1b1 T A 17: 79,710,611 M372L probably benign Het
Cyp2c66 T A 19: 39,163,470 S210T probably benign Het
Dnah1 G A 14: 31,282,418 P2385S probably benign Het
Dsp A C 13: 38,197,123 T2615P possibly damaging Het
Eif4g3 A G 4: 138,146,299 T682A probably benign Het
Enpp2 T C 15: 54,864,054 Y513C probably damaging Het
Ercc6 T C 14: 32,570,063 V1128A probably benign Het
Fam136b-ps C T 15: 31,276,716 probably benign Het
Fbxl7 T A 15: 26,789,554 H29L probably benign Het
Fbxw22 A G 9: 109,385,115 V211A probably benign Het
Frk A T 10: 34,484,284 K94* probably null Het
G0s2 T A 1: 193,272,562 E71D probably damaging Het
Gfpt1 A G 6: 87,053,745 probably null Het
Gga1 A G 15: 78,892,017 D420G possibly damaging Het
Gldc T C 19: 30,118,598 Q671R possibly damaging Het
Gpc6 A G 14: 117,186,769 T90A probably benign Het
Gucy2g C A 19: 55,229,787 V410F probably damaging Het
Ifnlr1 T C 4: 135,704,198 S233P probably benign Het
Ighv1-9 A T 12: 114,583,757 W55R probably damaging Het
Igsf10 T A 3: 59,328,293 H1489L probably benign Het
Il17re T C 6: 113,459,010 L39P probably damaging Het
Kcna2 T A 3: 107,104,637 V178D probably damaging Het
Kcnk3 A G 5: 30,622,386 H260R possibly damaging Het
Kctd19 T C 8: 105,391,999 Y287C probably damaging Het
Klhl28 A T 12: 64,957,712 M9K probably benign Het
Lama2 A G 10: 27,350,251 probably null Het
Lrrc27 A T 7: 139,214,799 D26V probably damaging Het
Mcm4 A G 16: 15,625,570 S830P probably damaging Het
Mei1 T A 15: 82,077,603 C188S possibly damaging Het
Mettl13 C T 1: 162,545,899 R261H possibly damaging Het
Mex3a A T 3: 88,536,387 I257F probably damaging Het
Mib1 A G 18: 10,793,002 E646G probably damaging Het
Mier2 T C 10: 79,549,577 D139G probably benign Het
Mmp14 T A 14: 54,439,113 Y372N probably damaging Het
Mrvi1 A G 7: 110,925,312 S208P probably benign Het
Myh14 A G 7: 44,616,248 V1569A possibly damaging Het
Myo18b T C 5: 112,761,346 E1977G probably damaging Het
Myo3b T C 2: 70,253,112 L675P probably damaging Het
N4bp1 A G 8: 86,860,537 V591A probably damaging Het
Nedd9 C A 13: 41,316,598 V360L probably benign Het
Oit3 C T 10: 59,424,027 R518H probably damaging Het
Olfr1122 T G 2: 87,388,163 C153G probably damaging Het
Olfr1413 T A 1: 92,573,413 S81T probably damaging Het
Olfr171 A G 16: 19,624,992 I36T possibly damaging Het
Olfr342 T A 2: 36,527,766 M118K probably damaging Het
Olfr531 A G 7: 140,400,569 V159A probably benign Het
Olfr744 A G 14: 50,618,474 N84S probably benign Het
Olfr744 T A 14: 50,618,740 C173S probably damaging Het
Olfr749 C A 14: 50,737,074 L29F probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pask A T 1: 93,330,874 C251S probably damaging Het
Pdzk1 A T 3: 96,850,321 D31V probably benign Het
Pmfbp1 A T 8: 109,530,155 Q497L probably damaging Het
Pofut1 T C 2: 153,261,566 probably benign Het
Polr2h A G 16: 20,721,966 N95S probably damaging Het
Pou2f3 A G 9: 43,145,281 V93A possibly damaging Het
Ppfia1 G A 7: 144,514,473 Q446* probably null Het
Prkd1 A T 12: 50,394,622 L327* probably null Het
Prrt4 T C 6: 29,177,512 E86G probably benign Het
Psen2 T C 1: 180,228,857 I393V probably benign Het
Psma2 G A 13: 14,616,028 V20I probably benign Het
Qser1 C T 2: 104,787,282 V1062I possibly damaging Het
Rab11b G T 17: 33,748,881 A114D probably damaging Het
Rag1 A T 2: 101,642,311 W829R probably damaging Het
Rgl3 A G 9: 21,988,044 probably null Het
Rgs8 C T 1: 153,665,904 T3I probably damaging Het
Rnf17 T C 14: 56,505,928 V1317A probably damaging Het
Rps6kb2 A T 19: 4,163,228 D6E probably damaging Het
Skint7 T C 4: 111,984,134 L257P probably damaging Het
Slc11a1 G A 1: 74,385,184 A434T probably damaging Het
Slc5a8 A T 10: 88,886,598 I98F possibly damaging Het
Sorl1 T C 9: 42,031,818 K921E possibly damaging Het
Stub1 A G 17: 25,832,138 L90P probably damaging Het
Sycp1 A T 3: 102,920,565 S289T probably damaging Het
Taar7b T G 10: 24,000,461 S175A probably benign Het
Tead3 T C 17: 28,341,477 K51R probably benign Het
Tmed11 T A 5: 108,795,223 I30L probably benign Het
Tmem131 A G 1: 36,854,905 I139T probably damaging Het
Tmem191c A G 16: 17,277,695 Q206R probably null Het
Tph2 T A 10: 115,151,174 Y237F probably benign Het
Trim35 C T 14: 66,308,972 probably benign Het
Tsc22d1 T C 14: 76,418,310 I661T probably benign Het
Ttc27 T A 17: 74,799,342 H541Q probably damaging Het
Uqcrq A G 11: 53,430,127 probably null Het
Vmn1r215 T A 13: 23,076,496 S235R probably benign Het
Vmn1r70 T C 7: 10,634,398 V271A probably benign Het
Vps13a G A 19: 16,654,484 R2596C probably benign Het
Vwa7 G A 17: 35,024,190 V615I probably benign Het
Wdr90 T C 17: 25,846,333 T1650A probably damaging Het
Zbtb32 T A 7: 30,591,466 M135L probably benign Het
Zc2hc1c A G 12: 85,290,514 D315G probably benign Het
Zfc3h1 T A 10: 115,418,783 C1427* probably null Het
Zfp30 A G 7: 29,786,266 probably benign Het
Zfp428 T A 7: 24,515,125 D55E probably damaging Het
Zfyve26 A T 12: 79,255,361 N1820K probably damaging Het
Zw10 C A 9: 49,077,459 S675* probably null Het
Other mutations in Skint5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Skint5 APN 4 113542873 critical splice donor site probably null
IGL01288:Skint5 APN 4 113524135 intron probably benign
IGL01313:Skint5 APN 4 113805164 missense unknown
IGL01446:Skint5 APN 4 113942822 missense probably damaging 1.00
IGL01861:Skint5 APN 4 113559824 splice site probably benign
IGL01955:Skint5 APN 4 113623736 critical splice donor site probably null
IGL02150:Skint5 APN 4 113885791 missense unknown
IGL02190:Skint5 APN 4 113940765 missense possibly damaging 0.93
IGL02271:Skint5 APN 4 113937581 splice site probably null
IGL02426:Skint5 APN 4 113940784 missense probably benign 0.08
IGL02484:Skint5 APN 4 113942553 nonsense probably null
IGL02548:Skint5 APN 4 113731076 missense unknown
IGL02556:Skint5 APN 4 113940735 missense probably damaging 0.99
IGL02674:Skint5 APN 4 113630385 splice site probably benign
IGL02697:Skint5 APN 4 113479713 missense probably benign 0.23
IGL02710:Skint5 APN 4 113477959 missense unknown
IGL02721:Skint5 APN 4 113942549 missense probably damaging 0.96
IGL02750:Skint5 APN 4 113539362 missense unknown
IGL03121:Skint5 APN 4 113717087 missense unknown
IGL03167:Skint5 APN 4 113893850 missense unknown
IGL03247:Skint5 APN 4 113940808 missense probably damaging 1.00
IGL03264:Skint5 APN 4 113486657 missense unknown
IGL03281:Skint5 APN 4 113667218 missense unknown
IGL03353:Skint5 APN 4 113742182 missense unknown
IGL03377:Skint5 APN 4 113763538 missense unknown
PIT4377001:Skint5 UTSW 4 113597703 missense unknown
R0006:Skint5 UTSW 4 113893862 splice site probably benign
R0026:Skint5 UTSW 4 113546468 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0096:Skint5 UTSW 4 113597768 splice site probably benign
R0277:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0323:Skint5 UTSW 4 113937621 missense probably benign 0.04
R0369:Skint5 UTSW 4 113512023 critical splice donor site probably null
R0375:Skint5 UTSW 4 113705596 missense unknown
R0464:Skint5 UTSW 4 113535731 missense unknown
R0479:Skint5 UTSW 4 113655672 missense unknown
R0507:Skint5 UTSW 4 113567930 splice site probably null
R0533:Skint5 UTSW 4 113827867 missense unknown
R0628:Skint5 UTSW 4 113731069 nonsense probably null
R0645:Skint5 UTSW 4 113763482 missense unknown
R1201:Skint5 UTSW 4 113556145 missense unknown
R1240:Skint5 UTSW 4 113717107 missense unknown
R1270:Skint5 UTSW 4 113942659 nonsense probably null
R1390:Skint5 UTSW 4 113655684 missense unknown
R1398:Skint5 UTSW 4 113779071 missense unknown
R1438:Skint5 UTSW 4 113556111 splice site probably benign
R1591:Skint5 UTSW 4 113999454 critical splice donor site probably null
R1631:Skint5 UTSW 4 113483926 missense probably benign 0.23
R1653:Skint5 UTSW 4 113490678 missense unknown
R1722:Skint5 UTSW 4 113846311 splice site probably null
R1735:Skint5 UTSW 4 113563459 missense unknown
R1765:Skint5 UTSW 4 113577661 missense unknown
R2054:Skint5 UTSW 4 113819163 critical splice donor site probably null
R2058:Skint5 UTSW 4 113870700 missense possibly damaging 0.53
R2197:Skint5 UTSW 4 113940849 missense probably damaging 1.00
R2239:Skint5 UTSW 4 113546536 missense unknown
R2380:Skint5 UTSW 4 113546536 missense unknown
R2406:Skint5 UTSW 4 113942667 missense probably damaging 0.97
R2512:Skint5 UTSW 4 113630419 missense unknown
R2913:Skint5 UTSW 4 113524092 intron probably benign
R3522:Skint5 UTSW 4 113756905 critical splice donor site probably null
R3779:Skint5 UTSW 4 113779040 splice site probably benign
R3815:Skint5 UTSW 4 113629122 splice site probably benign
R3815:Skint5 UTSW 4 113846299 missense possibly damaging 0.86
R3816:Skint5 UTSW 4 113629122 splice site probably benign
R3817:Skint5 UTSW 4 113629122 splice site probably benign
R3818:Skint5 UTSW 4 113629122 splice site probably benign
R3837:Skint5 UTSW 4 113940741 missense probably damaging 1.00
R3943:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R3944:Skint5 UTSW 4 113942753 missense probably damaging 1.00
R4037:Skint5 UTSW 4 113885814 missense unknown
R4038:Skint5 UTSW 4 113885814 missense unknown
R4039:Skint5 UTSW 4 113885814 missense unknown
R4280:Skint5 UTSW 4 113942552 missense probably damaging 1.00
R4308:Skint5 UTSW 4 113483967 missense unknown
R4386:Skint5 UTSW 4 113483893 missense probably benign 0.23
R4513:Skint5 UTSW 4 113742185 missense unknown
R4575:Skint5 UTSW 4 113667193 missense unknown
R4631:Skint5 UTSW 4 113629117 critical splice acceptor site probably null
R4722:Skint5 UTSW 4 113893855 missense unknown
R4854:Skint5 UTSW 4 113580528 missense unknown
R5010:Skint5 UTSW 4 113546537 missense unknown
R5158:Skint5 UTSW 4 113742212 missense unknown
R5163:Skint5 UTSW 4 113795565 missense unknown
R5190:Skint5 UTSW 4 113763514 missense unknown
R5232:Skint5 UTSW 4 113577644 missense unknown
R5257:Skint5 UTSW 4 113577662 missense unknown
R5499:Skint5 UTSW 4 113942503 critical splice donor site probably null
R5569:Skint5 UTSW 4 113688706 critical splice acceptor site probably null
R5776:Skint5 UTSW 4 113763503 missense unknown
R5986:Skint5 UTSW 4 113995648 missense probably benign 0.11
R5987:Skint5 UTSW 4 113885808 missense unknown
R5995:Skint5 UTSW 4 113893832 missense unknown
R6063:Skint5 UTSW 4 113490645 missense probably benign 0.23
R6074:Skint5 UTSW 4 113805200 missense unknown
R6111:Skint5 UTSW 4 113705648 missense unknown
R6173:Skint5 UTSW 4 113535710 missense unknown
R6238:Skint5 UTSW 4 113942867 splice site probably null
R6248:Skint5 UTSW 4 113779089 missense unknown
R6318:Skint5 UTSW 4 113517133 missense unknown
R6370:Skint5 UTSW 4 113614110 missense unknown
R6404:Skint5 UTSW 4 113942609 missense probably damaging 0.97
R6499:Skint5 UTSW 4 113539355 missense unknown
R6646:Skint5 UTSW 4 113940777 missense possibly damaging 0.94
R6737:Skint5 UTSW 4 113535739 missense unknown
R6795:Skint5 UTSW 4 113667223 missense unknown
R6815:Skint5 UTSW 4 113717127 critical splice acceptor site probably null
R6935:Skint5 UTSW 4 113942596 missense possibly damaging 0.56
R7028:Skint5 UTSW 4 113940839 missense probably damaging 1.00
R7043:Skint5 UTSW 4 113717107 missense unknown
R7071:Skint5 UTSW 4 113779080 missense unknown
R7142:Skint5 UTSW 4 113571594 missense unknown
R7197:Skint5 UTSW 4 113580482 critical splice donor site probably null
R7208:Skint5 UTSW 4 113539339 missense unknown
R7297:Skint5 UTSW 4 113542934 missense unknown
X0028:Skint5 UTSW 4 113691109 missense unknown
Predicted Primers PCR Primer
(F):5'- TCAGAAATCCACCTGCCTCTG -3'
(R):5'- AAGAAATACCATTGTGACAAAGAGCCT -3'

Sequencing Primer
(F):5'- CCTCCTGAGTGCTGGGATTAAAG -3'
(R):5'- CTGGAGTGAAAAGTGCAAGCTCTTTC -3'
Posted On2016-06-06