Incidental Mutation 'R0446:Emx2'
ID39418
Institutional Source Beutler Lab
Gene Symbol Emx2
Ensembl Gene ENSMUSG00000043969
Gene Nameempty spiracles homeobox 2
SynonymsPdo
MMRRC Submission 038647-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0446 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location59458372-59465357 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 59463916 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 211 (K211*)
Ref Sequence ENSEMBL: ENSMUSP00000053361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062216] [ENSMUST00000174353]
Predicted Effect probably null
Transcript: ENSMUST00000062216
AA Change: K211*
SMART Domains Protein: ENSMUSP00000053361
Gene: ENSMUSG00000043969
AA Change: K211*

DomainStartEndE-ValueType
low complexity region 76 109 N/A INTRINSIC
HOX 155 217 1.32e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174353
AA Change: Q48L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174573
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeobox-containing transcription factor that is the homolog to the 'empty spiracles' gene in Drosophila. Research on this gene in humans has focused on its expression in three tissues: dorsal telencephalon, olfactory neuroepithelium, and urogenetial system. It is expressed in the dorsal telencephalon during development in a low rostral-lateral to high caudal-medial gradient and is proposed to pattern the neocortex into defined functional areas. It is also expressed in embryonic and adult olfactory neuroepithelia where it complexes with eukaryotic translation initiation factor 4E (eIF4E) and possibly regulates mRNA transport or translation. In the developing urogenital system, it is expressed in epithelial tissues and is negatively regulated by HOXA10. Alternative splicing results in multiple transcript variants encoding distinct proteins.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous disruption of this gene causes neonatal death, impaired urogenital development and malformation of several forebrain regions. Heterozygotes for a null allele show middle and inner ear defects. Homozygotes for an ENU-induced allele die neonatally with middle ear defects and small kidneys. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik G A 2: 91,304,764 T20I possibly damaging Het
4930435E12Rik G A 16: 38,828,702 T15I probably benign Het
4933434E20Rik A G 3: 90,064,459 T42A probably benign Het
Actr3b T A 5: 25,831,732 I181K probably damaging Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
B3galt4 T C 17: 33,951,018 E82G probably benign Het
Bag1 G A 4: 40,936,609 T349I probably benign Het
Brip1 A T 11: 86,157,601 L305Q probably damaging Het
Cdipt A G 7: 126,978,264 T61A probably damaging Het
Cmya5 T A 13: 93,093,656 R1641S probably benign Het
Cog7 T C 7: 121,937,072 D515G probably benign Het
Cpsf4 T A 5: 145,177,244 L171Q probably damaging Het
Cuzd1 A T 7: 131,316,280 probably null Het
Dapk1 T A 13: 60,725,287 probably null Het
Diaph1 A G 18: 37,853,590 V1114A possibly damaging Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam170a T A 18: 50,280,632 C55S possibly damaging Het
Fbxw26 A G 9: 109,743,720 S119P probably benign Het
Fryl G A 5: 73,097,417 T894M possibly damaging Het
Gad1-ps C A 10: 99,445,521 noncoding transcript Het
Gm14124 A G 2: 150,268,073 T228A possibly damaging Het
Gss T C 2: 155,567,745 E257G probably benign Het
Klhdc1 A C 12: 69,283,308 S404R probably benign Het
Kmt2e T A 5: 23,497,534 probably null Het
Krt20 G A 11: 99,437,776 Q108* probably null Het
Lmnb1 T A 18: 56,743,259 S480T probably benign Het
Lyst T A 13: 13,638,048 M1015K probably benign Het
Mdm1 T G 10: 118,152,056 S290A probably benign Het
Mkln1 T A 6: 31,449,504 F238I probably damaging Het
Mrgprb3 A G 7: 48,643,236 V189A probably benign Het
Myrf G C 19: 10,218,162 T428S probably benign Het
Naip2 A C 13: 100,161,782 I582S probably benign Het
Neurod6 C T 6: 55,679,629 E8K probably benign Het
Nlrp12 T C 7: 3,234,029 I747V probably benign Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Obscn A T 11: 58,995,412 probably benign Het
Olfr1153 T C 2: 87,896,855 Y219H possibly damaging Het
Olfr1346 T C 7: 6,475,025 V305A probably benign Het
Olfr480 A T 7: 108,066,725 Y24* probably null Het
Olfr522 A T 7: 140,162,471 S160T probably damaging Het
Olfr920 G T 9: 38,755,818 L43F probably damaging Het
Olfr958 A T 9: 39,550,451 I140N probably damaging Het
Orc5 C T 5: 22,546,457 V85I probably benign Het
Pccb T C 9: 100,982,797 D468G probably damaging Het
Pdzd2 A T 15: 12,375,024 V1675E probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Pltp A T 2: 164,854,400 N97K probably damaging Het
Polr1a T C 6: 71,950,664 probably null Het
Prss42 G A 9: 110,799,273 V162I possibly damaging Het
Rbfox2 A T 15: 77,099,255 Y269N probably damaging Het
Rftn2 A T 1: 55,214,195 I83K probably damaging Het
S1pr4 A T 10: 81,498,989 I217N probably damaging Het
Slc23a2 T C 2: 132,078,433 K184R probably benign Het
Slc6a19 T C 13: 73,691,695 N156S probably benign Het
Svep1 C T 4: 58,088,280 G1723D probably damaging Het
Tbc1d32 T A 10: 56,192,898 H358L possibly damaging Het
Tigit G T 16: 43,662,271 N33K probably damaging Het
Tmem25 T C 9: 44,796,581 Y139C probably damaging Het
Trmt13 G A 3: 116,582,626 T372M probably damaging Het
Ubr2 A T 17: 46,983,298 M303K probably damaging Het
Usp34 A G 11: 23,467,207 E2952G probably damaging Het
Zan T A 5: 137,391,658 I4851F unknown Het
Zfand4 C T 6: 116,288,054 T160I probably benign Het
Other mutations in Emx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Emx2 APN 19 59459589 missense possibly damaging 0.83
IGL02103:Emx2 APN 19 59461698 missense probably benign 0.22
R0631:Emx2 UTSW 19 59464028 missense probably damaging 1.00
R1194:Emx2 UTSW 19 59459552 nonsense probably null
R1512:Emx2 UTSW 19 59459603 missense possibly damaging 0.95
R1526:Emx2 UTSW 19 59464010 missense probably benign 0.05
R2019:Emx2 UTSW 19 59459339 missense probably benign
R2066:Emx2 UTSW 19 59461698 missense probably benign 0.01
R2133:Emx2 UTSW 19 59464033 missense probably damaging 0.99
R4977:Emx2 UTSW 19 59459246 missense probably damaging 1.00
R5884:Emx2 UTSW 19 59464029 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAACGGCCATACTTTGGGCAC -3'
(R):5'- TTGCATGTTGATGATCGGGCCTCC -3'

Sequencing Primer
(F):5'- CTTGCTCTCAGAGGGAAGG -3'
(R):5'- TGTCCAAAGTCTGCTGCGAG -3'
Posted On2013-05-23