Incidental Mutation 'R5249:Olfr916'
ID398826
Institutional Source Beutler Lab
Gene Symbol Olfr916
Ensembl Gene ENSMUSG00000094701
Gene Nameolfactory receptor 916
SynonymsGA_x6K02T2PVTD-32360710-32359778, MOR168-1
MMRRC Submission 042820-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R5249 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38655052-38659875 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38658078 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 105 (C105R)
Ref Sequence ENSEMBL: ENSMUSP00000149578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081196] [ENSMUST00000213714] [ENSMUST00000214093] [ENSMUST00000215291]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081196
AA Change: C105R

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079959
Gene: ENSMUSG00000094701
AA Change: C105R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-45 PFAM
Pfam:7tm_1 41 290 1.3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213714
AA Change: C105R

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214093
AA Change: C105R

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000215291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217596
Meta Mutation Damage Score 0.1064 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,575,483 *719Q probably null Het
2810403A07Rik T A 3: 88,696,725 I283N probably damaging Het
A4gnt A G 9: 99,620,231 H148R probably damaging Het
Acrbp A G 6: 125,060,922 D394G probably damaging Het
Adam18 T C 8: 24,625,852 T609A probably benign Het
Adam25 T A 8: 40,755,954 N752K probably benign Het
Ano6 A C 15: 95,913,588 S176R probably benign Het
Ano7 T C 1: 93,375,196 S19P probably benign Het
Ap1b1 A G 11: 5,026,364 E437G probably damaging Het
Arfgap2 T A 2: 91,265,637 C46* probably null Het
Arhgef26 T A 3: 62,340,560 L355Q probably damaging Het
B4galnt4 C T 7: 141,065,070 T219I probably damaging Het
Bap1 C T 14: 31,257,286 probably benign Het
Catip T G 1: 74,362,795 L43R probably damaging Het
Ccdc177 G A 12: 80,758,508 R331C unknown Het
Cep85l T C 10: 53,319,594 probably null Het
Cfap206 T A 4: 34,714,502 Q398L probably benign Het
Clec18a A G 8: 111,073,736 C352R probably damaging Het
Clic6 A T 16: 92,539,451 Y549F probably damaging Het
Cpne9 C T 6: 113,293,073 probably benign Het
Cyb5r3 A C 15: 83,158,635 probably benign Het
Dnah6 C T 6: 73,113,488 R2293K probably damaging Het
Dnmbp C A 19: 43,902,440 R296L probably damaging Het
Dtwd1 C A 2: 126,154,774 Q60K probably benign Het
Esyt1 C A 10: 128,516,574 V723L probably benign Het
Fam71f1 A G 6: 29,323,897 D207G probably damaging Het
Fbxo42 T C 4: 141,199,024 L339P probably damaging Het
Furin A T 7: 80,393,421 N347K probably damaging Het
Fzd7 T C 1: 59,483,363 M135T probably damaging Het
Hlf A G 11: 90,387,806 M144T probably benign Het
Hyal5 C T 6: 24,876,649 Q174* probably null Het
Kcnb1 T A 2: 167,105,183 M582L possibly damaging Het
Kdm5d T C Y: 916,692 Y391H probably damaging Het
Kif21b C T 1: 136,169,228 T1297M probably damaging Het
Krt8 T G 15: 101,998,440 N317T possibly damaging Het
Lctl G T 9: 64,137,914 V372L probably benign Het
Lig1 C T 7: 13,308,507 H822Y possibly damaging Het
Lrrc4b A G 7: 44,462,564 D620G possibly damaging Het
Mboat4 C T 8: 34,115,121 H10Y probably benign Het
Med1 A T 11: 98,157,240 M910K probably benign Het
Mia2 A T 12: 59,108,125 D209V probably damaging Het
Mpp4 C T 1: 59,144,858 probably benign Het
Mrgprb1 A T 7: 48,447,477 V229E possibly damaging Het
Mtor T A 4: 148,463,732 C485S probably damaging Het
Mx1 T C 16: 97,457,428 D23G probably damaging Het
Myrfl T C 10: 116,783,233 D740G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nav2 G A 7: 49,535,913 V874I probably damaging Het
Ntrk3 A T 7: 78,461,166 N262K possibly damaging Het
Olfr819 C T 10: 129,966,209 A164T probably benign Het
Opa1 A T 16: 29,618,259 D699V probably damaging Het
Otud7a A G 7: 63,757,433 N495D possibly damaging Het
Pcsk9 T C 4: 106,463,753 D53G probably benign Het
Pdcd5 A G 7: 35,646,996 probably benign Het
Phf21a C T 2: 92,228,477 P28L probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Ppp1r35 C T 5: 137,779,144 probably benign Het
Ptprq T C 10: 107,699,635 Q423R probably damaging Het
Pum1 A T 4: 130,762,814 Y699F probably benign Het
Rabgef1 A G 5: 130,213,000 D415G probably benign Het
Rapgef6 A G 11: 54,523,117 E23G probably benign Het
Rpia G T 6: 70,783,579 C121* probably null Het
Serpinb13 T A 1: 106,998,697 W201R probably damaging Het
Sh3bp4 T C 1: 89,137,734 C17R probably damaging Het
Sh3d21 A G 4: 126,162,065 probably benign Het
Slamf6 A C 1: 171,936,682 N214T probably damaging Het
Slc7a2 T C 8: 40,908,093 Y365H possibly damaging Het
Sox18 T C 2: 181,671,178 probably null Het
Spink7 A T 18: 62,592,436 F79I possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Sspo A T 6: 48,493,310 H4561L probably damaging Het
Tcaf1 T C 6: 42,676,859 K700R probably benign Het
Tcf25 G T 8: 123,388,633 R203L probably damaging Het
Tcp11 T C 17: 28,071,783 I201V possibly damaging Het
Tex2 T C 11: 106,546,789 D685G unknown Het
Themis G T 10: 28,761,199 E100* probably null Het
Tmem52b G A 6: 129,514,258 probably null Het
Tnr C T 1: 159,684,656 probably benign Het
Tox3 T C 8: 90,248,816 I396V probably benign Het
Tpm2 T A 4: 43,514,828 E269V probably benign Het
Tulp1 C T 17: 28,362,677 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ube2j2 A C 4: 155,949,058 K30Q possibly damaging Het
Usp19 T A 9: 108,492,608 M1K probably null Het
Vmn2r52 C A 7: 10,176,270 R6L probably benign Het
Zbed4 G A 15: 88,781,087 V453M probably benign Het
Zfp319 T C 8: 95,328,471 E368G probably benign Het
Zfp366 A C 13: 99,229,609 E426A probably damaging Het
Zfp687 A T 3: 95,009,466 I783N probably damaging Het
Other mutations in Olfr916
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Olfr916 APN 9 38657622 missense probably benign 0.00
IGL02313:Olfr916 APN 9 38658066 missense probably damaging 0.97
IGL03221:Olfr916 APN 9 38658365 missense probably damaging 0.99
R0479:Olfr916 UTSW 9 38658182 missense probably damaging 1.00
R1507:Olfr916 UTSW 9 38658014 missense probably damaging 1.00
R1521:Olfr916 UTSW 9 38657718 missense probably damaging 0.99
R1860:Olfr916 UTSW 9 38658365 missense probably damaging 0.99
R3107:Olfr916 UTSW 9 38658011 missense possibly damaging 0.48
R3964:Olfr916 UTSW 9 38657727 missense probably benign 0.42
R3965:Olfr916 UTSW 9 38657727 missense probably benign 0.42
R4419:Olfr916 UTSW 9 38658069 missense probably benign 0.01
R5481:Olfr916 UTSW 9 38657620 missense probably benign 0.00
R6299:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6555:Olfr916 UTSW 9 38658289 missense probably benign 0.00
R6702:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6703:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6851:Olfr916 UTSW 9 38658185 missense probably benign 0.31
R6895:Olfr916 UTSW 9 38658089 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTCATTATGCAAACAGTGTGAGCC -3'
(R):5'- TGGCAATGTACCTAGTCACTG -3'

Sequencing Primer
(F):5'- GTGTGAGCCACAGACTCAG -3'
(R):5'- CAATGTACCTAGTCACTGCATTGGG -3'
Posted On2016-07-06