Incidental Mutation 'R5249:Themis'
ID398834
Institutional Source Beutler Lab
Gene Symbol Themis
Ensembl Gene ENSMUSG00000049109
Gene Namethymocyte selection associated
SynonymsTsepa, Gasp, E430004N04Rik
MMRRC Submission 042820-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R5249 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location28668360-28883818 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 28761199 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 100 (E100*)
Ref Sequence ENSEMBL: ENSMUSP00000101155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056097] [ENSMUST00000060409] [ENSMUST00000105516] [ENSMUST00000159927] [ENSMUST00000161345]
Predicted Effect probably null
Transcript: ENSMUST00000056097
AA Change: E100*
SMART Domains Protein: ENSMUSP00000060129
Gene: ENSMUSG00000049109
AA Change: E100*

DomainStartEndE-ValueType
Pfam:CABIT 17 266 5.2e-59 PFAM
Pfam:CABIT 282 530 3.7e-48 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000060409
AA Change: E100*
SMART Domains Protein: ENSMUSP00000055315
Gene: ENSMUSG00000049109
AA Change: E100*

DomainStartEndE-ValueType
Pfam:CABIT 17 272 9.3e-52 PFAM
Pfam:CABIT 282 532 5e-62 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105516
AA Change: E100*
SMART Domains Protein: ENSMUSP00000101155
Gene: ENSMUSG00000049109
AA Change: E100*

DomainStartEndE-ValueType
Pfam:CABIT 17 272 9e-52 PFAM
Pfam:CABIT 282 532 4.9e-62 PFAM
low complexity region 550 564 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159927
SMART Domains Protein: ENSMUSP00000123919
Gene: ENSMUSG00000049109

DomainStartEndE-ValueType
Pfam:CABIT 17 91 1.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161345
SMART Domains Protein: ENSMUSP00000123894
Gene: ENSMUSG00000049109

DomainStartEndE-ValueType
Pfam:CABIT 17 86 1.9e-9 PFAM
Pfam:CABIT 129 203 5.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162343
Meta Mutation Damage Score 0.694 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: This gene encodes a protein that plays a regulatory role in both positive and negative T-cell selection during late thymocyte development. The protein functions through T-cell antigen receptor signaling, and is necessary for proper lineage commitment and maturation of T-cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous null mice have defects in T cell positive selection that leads to very few alpha-beta T cells being found in the periphery. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,575,483 *719Q probably null Het
2810403A07Rik T A 3: 88,696,725 I283N probably damaging Het
A4gnt A G 9: 99,620,231 H148R probably damaging Het
Acrbp A G 6: 125,060,922 D394G probably damaging Het
Adam18 T C 8: 24,625,852 T609A probably benign Het
Adam25 T A 8: 40,755,954 N752K probably benign Het
Ano6 A C 15: 95,913,588 S176R probably benign Het
Ano7 T C 1: 93,375,196 S19P probably benign Het
Ap1b1 A G 11: 5,026,364 E437G probably damaging Het
Arfgap2 T A 2: 91,265,637 C46* probably null Het
Arhgef26 T A 3: 62,340,560 L355Q probably damaging Het
B4galnt4 C T 7: 141,065,070 T219I probably damaging Het
Bap1 C T 14: 31,257,286 probably benign Het
Catip T G 1: 74,362,795 L43R probably damaging Het
Ccdc177 G A 12: 80,758,508 R331C unknown Het
Cep85l T C 10: 53,319,594 probably null Het
Cfap206 T A 4: 34,714,502 Q398L probably benign Het
Clec18a A G 8: 111,073,736 C352R probably damaging Het
Clic6 A T 16: 92,539,451 Y549F probably damaging Het
Cpne9 C T 6: 113,293,073 probably benign Het
Cyb5r3 A C 15: 83,158,635 probably benign Het
Dnah6 C T 6: 73,113,488 R2293K probably damaging Het
Dnmbp C A 19: 43,902,440 R296L probably damaging Het
Dtwd1 C A 2: 126,154,774 Q60K probably benign Het
Esyt1 C A 10: 128,516,574 V723L probably benign Het
Fam71f1 A G 6: 29,323,897 D207G probably damaging Het
Fbxo42 T C 4: 141,199,024 L339P probably damaging Het
Furin A T 7: 80,393,421 N347K probably damaging Het
Fzd7 T C 1: 59,483,363 M135T probably damaging Het
Hlf A G 11: 90,387,806 M144T probably benign Het
Hyal5 C T 6: 24,876,649 Q174* probably null Het
Kcnb1 T A 2: 167,105,183 M582L possibly damaging Het
Kdm5d T C Y: 916,692 Y391H probably damaging Het
Kif21b C T 1: 136,169,228 T1297M probably damaging Het
Krt8 T G 15: 101,998,440 N317T possibly damaging Het
Lctl G T 9: 64,137,914 V372L probably benign Het
Lig1 C T 7: 13,308,507 H822Y possibly damaging Het
Lrrc4b A G 7: 44,462,564 D620G possibly damaging Het
Mboat4 C T 8: 34,115,121 H10Y probably benign Het
Med1 A T 11: 98,157,240 M910K probably benign Het
Mia2 A T 12: 59,108,125 D209V probably damaging Het
Mpp4 C T 1: 59,144,858 probably benign Het
Mrgprb1 A T 7: 48,447,477 V229E possibly damaging Het
Mtor T A 4: 148,463,732 C485S probably damaging Het
Mx1 T C 16: 97,457,428 D23G probably damaging Het
Myrfl T C 10: 116,783,233 D740G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nav2 G A 7: 49,535,913 V874I probably damaging Het
Ntrk3 A T 7: 78,461,166 N262K possibly damaging Het
Olfr819 C T 10: 129,966,209 A164T probably benign Het
Olfr916 A G 9: 38,658,078 C105R possibly damaging Het
Opa1 A T 16: 29,618,259 D699V probably damaging Het
Otud7a A G 7: 63,757,433 N495D possibly damaging Het
Pcsk9 T C 4: 106,463,753 D53G probably benign Het
Pdcd5 A G 7: 35,646,996 probably benign Het
Phf21a C T 2: 92,228,477 P28L probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Ppp1r35 C T 5: 137,779,144 probably benign Het
Ptprq T C 10: 107,699,635 Q423R probably damaging Het
Pum1 A T 4: 130,762,814 Y699F probably benign Het
Rabgef1 A G 5: 130,213,000 D415G probably benign Het
Rapgef6 A G 11: 54,523,117 E23G probably benign Het
Rpia G T 6: 70,783,579 C121* probably null Het
Serpinb13 T A 1: 106,998,697 W201R probably damaging Het
Sh3bp4 T C 1: 89,137,734 C17R probably damaging Het
Sh3d21 A G 4: 126,162,065 probably benign Het
Slamf6 A C 1: 171,936,682 N214T probably damaging Het
Slc7a2 T C 8: 40,908,093 Y365H possibly damaging Het
Sox18 T C 2: 181,671,178 probably null Het
Spink7 A T 18: 62,592,436 F79I possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Sspo A T 6: 48,493,310 H4561L probably damaging Het
Tcaf1 T C 6: 42,676,859 K700R probably benign Het
Tcf25 G T 8: 123,388,633 R203L probably damaging Het
Tcp11 T C 17: 28,071,783 I201V possibly damaging Het
Tex2 T C 11: 106,546,789 D685G unknown Het
Tmem52b G A 6: 129,514,258 probably null Het
Tnr C T 1: 159,684,656 probably benign Het
Tox3 T C 8: 90,248,816 I396V probably benign Het
Tpm2 T A 4: 43,514,828 E269V probably benign Het
Tulp1 C T 17: 28,362,677 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ube2j2 A C 4: 155,949,058 K30Q possibly damaging Het
Usp19 T A 9: 108,492,608 M1K probably null Het
Vmn2r52 C A 7: 10,176,270 R6L probably benign Het
Zbed4 G A 15: 88,781,087 V453M probably benign Het
Zfp319 T C 8: 95,328,471 E368G probably benign Het
Zfp366 A C 13: 99,229,609 E426A probably damaging Het
Zfp687 A T 3: 95,009,466 I783N probably damaging Het
Other mutations in Themis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Themis APN 10 28668753 splice site probably benign
IGL01729:Themis APN 10 28761591 nonsense probably null
IGL01833:Themis APN 10 28782311 nonsense probably null
IGL02582:Themis APN 10 28761547 missense probably benign 0.00
IGL02835:Themis APN 10 28761620 intron probably benign
cloudies UTSW 10 28761199 nonsense probably null
currant UTSW 10 28782011 missense probably damaging 1.00
death_valley UTSW 10 28668727 missense probably damaging 1.00
Meteor UTSW 10 28781832 missense possibly damaging 0.90
R0445:Themis UTSW 10 28782011 missense probably damaging 1.00
R0507:Themis UTSW 10 28781832 missense possibly damaging 0.90
R0709:Themis UTSW 10 28761574 missense probably benign 0.00
R1170:Themis UTSW 10 28668748 missense possibly damaging 0.80
R1442:Themis UTSW 10 28782135 missense probably damaging 0.96
R1844:Themis UTSW 10 28781757 missense probably damaging 1.00
R2004:Themis UTSW 10 28782724 missense probably benign 0.28
R2150:Themis UTSW 10 28668727 missense probably damaging 1.00
R2358:Themis UTSW 10 28863380 missense possibly damaging 0.57
R4529:Themis UTSW 10 28782335 missense possibly damaging 0.92
R4693:Themis UTSW 10 28782651 missense probably damaging 1.00
R4717:Themis UTSW 10 28789752 missense probably benign
R4801:Themis UTSW 10 28761511 missense probably benign 0.21
R4802:Themis UTSW 10 28761511 missense probably benign 0.21
R5557:Themis UTSW 10 28781886 missense possibly damaging 0.90
R5569:Themis UTSW 10 28781891 missense possibly damaging 0.95
R5640:Themis UTSW 10 28863376 missense probably damaging 0.99
R5735:Themis UTSW 10 28722534 missense probably benign 0.09
R6467:Themis UTSW 10 28781766 missense possibly damaging 0.47
R6523:Themis UTSW 10 28781898 missense possibly damaging 0.65
R6727:Themis UTSW 10 28781907 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACTTATGTCTACACACATGC -3'
(R):5'- CCTTCTTGTGACAATGGCAAAG -3'

Sequencing Primer
(F):5'- TTCCTACGAGAACTTTCATTA -3'
(R):5'- AAATGAGTGGCTCTGATGATTCC -3'
Posted On2016-07-06