Incidental Mutation 'R5249:Lrrc4b'
ID398794
Institutional Source Beutler Lab
Gene Symbol Lrrc4b
Ensembl Gene ENSMUSG00000047085
Gene Nameleucine rich repeat containing 4B
SynonymsLrig4
MMRRC Submission 042820-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R5249 (G1)
Quality Score191
Status Validated
Chromosome7
Chromosomal Location44429018-44463351 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44462564 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 620 (D620G)
Ref Sequence ENSEMBL: ENSMUSP00000053123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035929] [ENSMUST00000058667] [ENSMUST00000127790] [ENSMUST00000135624] [ENSMUST00000146128] [ENSMUST00000152902] [ENSMUST00000156093] [ENSMUST00000156957]
PDB Structure
CRYSTAL STRUCTURE OF THE N-TERMINAL LEUCINE RICH REPEATS OF NETRIN-G LIGAND-3 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE N-TERMINAL LEUCINE RICH REPEATS AND IMMUNOGLOBULIN DOMAIN OF NETRIN-G LIGAND-3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035929
SMART Domains Protein: ENSMUSP00000039202
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 17 128 3.8e-24 PFAM
Pfam:DUF108 174 265 2.9e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000058667
AA Change: D620G

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053123
Gene: ENSMUSG00000047085
AA Change: D620G

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
LRR 208 229 1.62e2 SMART
LRR_TYP 230 253 3.63e-3 SMART
LRR 254 277 9.75e0 SMART
LRR_TYP 278 301 5.29e-5 SMART
LRRCT 313 364 1.92e-3 SMART
IGc2 378 445 1.45e-9 SMART
low complexity region 462 482 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 624 644 N/A INTRINSIC
low complexity region 673 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127790
SMART Domains Protein: ENSMUSP00000123389
Gene: ENSMUSG00000047085

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133801
Predicted Effect probably benign
Transcript: ENSMUST00000135624
Predicted Effect probably benign
Transcript: ENSMUST00000146128
SMART Domains Protein: ENSMUSP00000119474
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:NAD_binding_3 5 110 1e-19 PFAM
Pfam:DUF108 153 252 7.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152902
Predicted Effect probably benign
Transcript: ENSMUST00000156093
SMART Domains Protein: ENSMUSP00000119374
Gene: ENSMUSG00000047085

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
LRRNT 58 92 5.6e-8 SMART
LRR 91 110 1.62e2 SMART
LRR 111 134 1.16e-1 SMART
LRR_TYP 135 158 8.22e-2 SMART
LRR_TYP 159 182 5.99e-4 SMART
Blast:LRR 183 207 2e-6 BLAST
LRR 208 230 3.65e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156957
SMART Domains Protein: ENSMUSP00000121766
Gene: ENSMUSG00000038704

DomainStartEndE-ValueType
Pfam:DUF108 52 151 2.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207591
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (93/95)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,575,483 *719Q probably null Het
2810403A07Rik T A 3: 88,696,725 I283N probably damaging Het
A4gnt A G 9: 99,620,231 H148R probably damaging Het
Acrbp A G 6: 125,060,922 D394G probably damaging Het
Adam18 T C 8: 24,625,852 T609A probably benign Het
Adam25 T A 8: 40,755,954 N752K probably benign Het
Ano6 A C 15: 95,913,588 S176R probably benign Het
Ano7 T C 1: 93,375,196 S19P probably benign Het
Ap1b1 A G 11: 5,026,364 E437G probably damaging Het
Arfgap2 T A 2: 91,265,637 C46* probably null Het
Arhgef26 T A 3: 62,340,560 L355Q probably damaging Het
B4galnt4 C T 7: 141,065,070 T219I probably damaging Het
Bap1 C T 14: 31,257,286 probably benign Het
Catip T G 1: 74,362,795 L43R probably damaging Het
Ccdc177 G A 12: 80,758,508 R331C unknown Het
Cep85l T C 10: 53,319,594 probably null Het
Cfap206 T A 4: 34,714,502 Q398L probably benign Het
Clec18a A G 8: 111,073,736 C352R probably damaging Het
Clic6 A T 16: 92,539,451 Y549F probably damaging Het
Cpne9 C T 6: 113,293,073 probably benign Het
Cyb5r3 A C 15: 83,158,635 probably benign Het
Dnah6 C T 6: 73,113,488 R2293K probably damaging Het
Dnmbp C A 19: 43,902,440 R296L probably damaging Het
Dtwd1 C A 2: 126,154,774 Q60K probably benign Het
Esyt1 C A 10: 128,516,574 V723L probably benign Het
Fam71f1 A G 6: 29,323,897 D207G probably damaging Het
Fbxo42 T C 4: 141,199,024 L339P probably damaging Het
Furin A T 7: 80,393,421 N347K probably damaging Het
Fzd7 T C 1: 59,483,363 M135T probably damaging Het
Hlf A G 11: 90,387,806 M144T probably benign Het
Hyal5 C T 6: 24,876,649 Q174* probably null Het
Kcnb1 T A 2: 167,105,183 M582L possibly damaging Het
Kdm5d T C Y: 916,692 Y391H probably damaging Het
Kif21b C T 1: 136,169,228 T1297M probably damaging Het
Krt8 T G 15: 101,998,440 N317T possibly damaging Het
Lctl G T 9: 64,137,914 V372L probably benign Het
Lig1 C T 7: 13,308,507 H822Y possibly damaging Het
Mboat4 C T 8: 34,115,121 H10Y probably benign Het
Med1 A T 11: 98,157,240 M910K probably benign Het
Mia2 A T 12: 59,108,125 D209V probably damaging Het
Mpp4 C T 1: 59,144,858 probably benign Het
Mrgprb1 A T 7: 48,447,477 V229E possibly damaging Het
Mtor T A 4: 148,463,732 C485S probably damaging Het
Mx1 T C 16: 97,457,428 D23G probably damaging Het
Myrfl T C 10: 116,783,233 D740G probably benign Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nav2 G A 7: 49,535,913 V874I probably damaging Het
Ntrk3 A T 7: 78,461,166 N262K possibly damaging Het
Olfr819 C T 10: 129,966,209 A164T probably benign Het
Olfr916 A G 9: 38,658,078 C105R possibly damaging Het
Opa1 A T 16: 29,618,259 D699V probably damaging Het
Otud7a A G 7: 63,757,433 N495D possibly damaging Het
Pcsk9 T C 4: 106,463,753 D53G probably benign Het
Pdcd5 A G 7: 35,646,996 probably benign Het
Phf21a C T 2: 92,228,477 P28L probably damaging Het
Pitpnm1 T A 19: 4,108,130 D573E probably damaging Het
Ppp1r35 C T 5: 137,779,144 probably benign Het
Ptprq T C 10: 107,699,635 Q423R probably damaging Het
Pum1 A T 4: 130,762,814 Y699F probably benign Het
Rabgef1 A G 5: 130,213,000 D415G probably benign Het
Rapgef6 A G 11: 54,523,117 E23G probably benign Het
Rpia G T 6: 70,783,579 C121* probably null Het
Serpinb13 T A 1: 106,998,697 W201R probably damaging Het
Sh3bp4 T C 1: 89,137,734 C17R probably damaging Het
Sh3d21 A G 4: 126,162,065 probably benign Het
Slamf6 A C 1: 171,936,682 N214T probably damaging Het
Slc7a2 T C 8: 40,908,093 Y365H possibly damaging Het
Sox18 T C 2: 181,671,178 probably null Het
Spink7 A T 18: 62,592,436 F79I possibly damaging Het
Srpk3 C T X: 73,774,949 R82* probably null Het
Sspo A T 6: 48,493,310 H4561L probably damaging Het
Tcaf1 T C 6: 42,676,859 K700R probably benign Het
Tcf25 G T 8: 123,388,633 R203L probably damaging Het
Tcp11 T C 17: 28,071,783 I201V possibly damaging Het
Tex2 T C 11: 106,546,789 D685G unknown Het
Themis G T 10: 28,761,199 E100* probably null Het
Tmem52b G A 6: 129,514,258 probably null Het
Tnr C T 1: 159,684,656 probably benign Het
Tox3 T C 8: 90,248,816 I396V probably benign Het
Tpm2 T A 4: 43,514,828 E269V probably benign Het
Tulp1 C T 17: 28,362,677 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ube2j2 A C 4: 155,949,058 K30Q possibly damaging Het
Usp19 T A 9: 108,492,608 M1K probably null Het
Vmn2r52 C A 7: 10,176,270 R6L probably benign Het
Zbed4 G A 15: 88,781,087 V453M probably benign Het
Zfp319 T C 8: 95,328,471 E368G probably benign Het
Zfp366 A C 13: 99,229,609 E426A probably damaging Het
Zfp687 A T 3: 95,009,466 I783N probably damaging Het
Other mutations in Lrrc4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0165:Lrrc4b UTSW 7 44462315 missense probably damaging 0.99
R1398:Lrrc4b UTSW 7 44462452 missense probably benign 0.44
R1421:Lrrc4b UTSW 7 44461051 missense probably benign 0.00
R1622:Lrrc4b UTSW 7 44462230 unclassified probably benign
R1681:Lrrc4b UTSW 7 44461177 missense probably damaging 0.99
R1778:Lrrc4b UTSW 7 44462399 missense probably benign
R1967:Lrrc4b UTSW 7 44462230 unclassified probably benign
R1989:Lrrc4b UTSW 7 44462230 unclassified probably benign
R2427:Lrrc4b UTSW 7 44462552 missense probably damaging 1.00
R3820:Lrrc4b UTSW 7 44462558 missense probably damaging 1.00
R3822:Lrrc4b UTSW 7 44462558 missense probably damaging 1.00
R4774:Lrrc4b UTSW 7 44462372 unclassified probably null
R5268:Lrrc4b UTSW 7 44461363 missense probably damaging 1.00
R6029:Lrrc4b UTSW 7 44462330 missense probably benign 0.00
R6984:Lrrc4b UTSW 7 44461298 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CGCTTAAGGACCTAGACGATG -3'
(R):5'- CTCTTGAAGAGCAGAGGTTCG -3'

Sequencing Primer
(F):5'- CTTAAGGACCTAGACGATGTCATG -3'
(R):5'- TTGAAGAGCAGAGGTTCGTGGATG -3'
Posted On2016-07-06