Mutagenetix > Incidental Mutation

Incidental Mutation 'R5245:Cntfr'

401099

Institutional Source

Beutler Lab

Gene Symbol

Cntfr

Ensembl Gene

ENSMUSG00000028444

Gene Name

ciliary neurotrophic factor receptor

Synonyms

Cntfralpha

MMRRC Submission

042816-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5245 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41657498-41697089 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 41670879 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 95 (W95R)

Ref Sequence

ENSEMBL: ENSMUSP00000100027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102961] [ENSMUST00000102962] [ENSMUST00000145379]

AlphaFold

O88507

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000064443

SMART Domains

Protein: ENSMUSP00000066076
Gene: ENSMUSG00000028444

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	37	96	1.87e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000084701

SMART Domains

Protein: ENSMUSP00000081751
Gene: ENSMUSG00000028444

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	37	96	1.87e-12	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102961
AA Change: W95R

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000100026
Gene: ENSMUSG00000028444
AA Change: W95R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	37	96	1.87e-12	SMART
Blast:FN3	106	190	8e-37	BLAST
FN3	204	290	1.1e-7	SMART
low complexity region	309	332	N/A	INTRINSIC
low complexity region	356	371	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102962
AA Change: W95R

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000100027
Gene: ENSMUSG00000028444
AA Change: W95R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	37	96	1.87e-12	SMART
Blast:FN3	106	190	8e-37	BLAST
FN3	204	290	1.1e-7	SMART
low complexity region	309	332	N/A	INTRINSIC
low complexity region	356	371	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145379

SMART Domains

Protein: ENSMUSP00000115631
Gene: ENSMUSG00000028444

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Blast:IGc2	37	60	2e-9	BLAST

Meta Mutation Damage Score

0.0674

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.3%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: This gene encodes the alpha subunit of the ciliary neurotrophic factor (CNTF) receptor that triggers the assembly of a trimolecular complex upon binding to CNTF, and initiate a downstream signaling process. The encoded preproprotein undergoes proteolytic processing to generate a glycosylphosphatidylinositol-linked cell surface protein. Mice lacking the encoded protein die shortly after birth and exhibit a reduction of motoneuron number at birth. The transgenic disruption of this gene specifically in the skeletal muscle followed by a peripheral nerve lesion impairs motor neuron axonal regeneration across the lesion site. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous mutant animals exhibit a significant reduction in the number of motor neurons. Neonatal mutants fail to suckle and die within 24 hours after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd17b	T	A	19: 21,661,624 (GRCm39)	Y270*	probably null	Het
Akap9	A	T	5: 4,026,209 (GRCm39)	Q59L	probably damaging	Het
Aloxe3	A	T	11: 69,020,502 (GRCm39)	Q182L	probably benign	Het
Arhgef5	G	T	6: 43,242,614 (GRCm39)		probably benign	Het
Bcas3	T	A	11: 85,449,912 (GRCm39)	N663K	probably damaging	Het
Cimap3	T	C	3: 105,921,770 (GRCm39)	H51R	possibly damaging	Het
Dcun1d4	A	G	5: 73,714,657 (GRCm39)	T275A	probably benign	Het
Eps8l1	A	G	7: 4,473,873 (GRCm39)	R227G	probably damaging	Het
Ets2	G	A	16: 95,513,304 (GRCm39)	W160*	probably null	Het
Flt4	AC	ACC	11: 49,541,861 (GRCm39)		probably null	Het
Fsip2	A	G	2: 82,823,505 (GRCm39)	M6413V	probably benign	Het
Gm14401	C	T	2: 176,778,471 (GRCm39)	P186S	probably damaging	Het
Hrc	G	A	7: 44,984,855 (GRCm39)	G2D	probably damaging	Het
Kcnq3	A	G	15: 65,903,284 (GRCm39)	V142A	possibly damaging	Het
Lama3	G	A	18: 12,552,950 (GRCm39)	C454Y	probably damaging	Het
Lrrk2	A	G	15: 91,680,292 (GRCm39)	T2068A	probably damaging	Het
Mab21l2	T	C	3: 86,454,799 (GRCm39)	E67G	possibly damaging	Het
Map3k5	G	A	10: 20,016,437 (GRCm39)	V1343I	probably benign	Het
Mcm4	T	A	16: 15,448,289 (GRCm39)	T423S	probably benign	Het
Mmp16	A	G	4: 18,054,596 (GRCm39)		probably benign	Het
Nat3	C	T	8: 68,000,832 (GRCm39)	T237I	probably benign	Het
Nol4	A	T	18: 22,828,179 (GRCm39)	*484R	probably null	Het
Nsmf	A	G	2: 24,946,119 (GRCm39)	E202G	probably damaging	Het
Olfml2b	T	C	1: 170,496,443 (GRCm39)	V358A	probably benign	Het
Or2v2	T	A	11: 49,004,116 (GRCm39)	I146F	probably benign	Het
Or4b1d	T	A	2: 89,968,606 (GRCm39)	K292N	probably damaging	Het
Osbpl1a	T	C	18: 12,891,910 (GRCm39)	E466G	probably damaging	Het
Pim3	A	G	15: 88,747,404 (GRCm39)	E90G	possibly damaging	Het
Recql5	T	C	11: 115,784,385 (GRCm39)	E905G	probably damaging	Het
Rnf31	T	G	14: 55,839,163 (GRCm39)	L925R	probably damaging	Het
Secisbp2l	A	G	2: 125,589,511 (GRCm39)	V679A	probably damaging	Het
Setdb2	T	A	14: 59,663,943 (GRCm39)	E68V	probably null	Het
Shtn1	T	A	19: 59,020,652 (GRCm39)	N190I	possibly damaging	Het
Slc25a25	G	A	2: 32,311,340 (GRCm39)	Q14*	probably null	Het
Snrnp27	A	G	6: 86,659,941 (GRCm39)	S18P	unknown	Het
Srsf11	C	T	3: 157,728,981 (GRCm39)		probably benign	Het
Tbx5	T	C	5: 120,021,230 (GRCm39)	V412A	possibly damaging	Het
Tcea3	A	G	4: 135,991,813 (GRCm39)	T166A	probably benign	Het
Tdrp	A	T	8: 14,024,479 (GRCm39)		probably benign	Het
Tent5a	G	T	9: 85,208,401 (GRCm39)	Q160K	possibly damaging	Het
Tmem132e	T	C	11: 82,333,464 (GRCm39)	V624A	probably damaging	Het
Tnnt1	T	C	7: 4,513,066 (GRCm39)	D72G	probably damaging	Het
Trim80	C	A	11: 115,332,398 (GRCm39)	H197N	probably damaging	Het
Zfp322a	A	T	13: 23,541,156 (GRCm39)	C195*	probably null	Het
Zfp335	A	G	2: 164,736,678 (GRCm39)	S986P	probably benign	Het

Other mutations in Cntfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1215:Cntfr	UTSW	4	41,662,064 (GRCm39)	missense	probably damaging	1.00
R1635:Cntfr	UTSW	4	41,658,816 (GRCm39)	missense	probably damaging	1.00
R1795:Cntfr	UTSW	4	41,670,841 (GRCm39)	critical splice donor site	probably null
R2115:Cntfr	UTSW	4	41,663,534 (GRCm39)	splice site	probably null
R2437:Cntfr	UTSW	4	41,671,035 (GRCm39)	missense	probably damaging	0.99
R4056:Cntfr	UTSW	4	41,658,900 (GRCm39)	missense	probably damaging	0.99
R4770:Cntfr	UTSW	4	41,663,282 (GRCm39)	missense	possibly damaging	0.57
R5346:Cntfr	UTSW	4	41,675,042 (GRCm39)	nonsense	probably null
R5436:Cntfr	UTSW	4	41,663,322 (GRCm39)	missense	probably damaging	0.98
R5535:Cntfr	UTSW	4	41,663,216 (GRCm39)	missense	probably benign	0.44
R6275:Cntfr	UTSW	4	41,663,216 (GRCm39)	missense	possibly damaging	0.89
R6749:Cntfr	UTSW	4	41,663,232 (GRCm39)	missense	possibly damaging	0.47
R7626:Cntfr	UTSW	4	41,662,013 (GRCm39)	missense	possibly damaging	0.89
R9006:Cntfr	UTSW	4	41,661,971 (GRCm39)	critical splice donor site	probably null
R9524:Cntfr	UTSW	4	41,661,995 (GRCm39)	missense	probably damaging	1.00
R9736:Cntfr	UTSW	4	41,658,290 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCACTGAGCAAGATGAGACTC -3'
(R):5'- ACGTGCAGTATGAGCGTCTG -3'

Sequencing Primer
(F):5'- CAAGATGAGACTCAAGAGGTCC -3'
(R):5'- TCTGGGCGCAGATGTGAC -3'

Posted On

2016-07-06