Incidental Mutation 'R5189:Il12rb1'
ID405059
Institutional Source Beutler Lab
Gene Symbol Il12rb1
Ensembl Gene ENSMUSG00000000791
Gene Nameinterleukin 12 receptor, beta 1
SynonymsIL-12R[b], CD212
MMRRC Submission 042767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5189 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70808449-70821424 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70811058 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 88 (T88A)
Ref Sequence ENSEMBL: ENSMUSP00000148279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000808] [ENSMUST00000212146] [ENSMUST00000212657]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000808
AA Change: T88A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000000808
Gene: ENSMUSG00000000791
AA Change: T88A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
FN3 467 550 9.4e-7 SMART
transmembrane domain 567 589 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211936
Predicted Effect possibly damaging
Transcript: ENSMUST00000212146
AA Change: T67A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212251
Predicted Effect possibly damaging
Transcript: ENSMUST00000212657
AA Change: T88A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212826
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein that belongs to the hemopoietin receptor superfamily. This protein binds to interleukine 12 (IL12) with a low affinity, and is thought to be a part of IL12 receptor complex. This protein forms a disulfide-linked oligomer, which is required for its IL12 binding activity. The coexpression of this and IL12RB2 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. Mutations in this gene impair the development of interleukin-17-producing T lymphocytes and result in increased susceptibility to mycobacterial and Salmonella infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased serum IFN-gamma levels in response to recombinant IL-12 or LPS treatment, and failure of ConA-activated splenocytes to proliferate or secrete IFN-gamma in response to IL-12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik C T 12: 71,193,349 T1311I possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
4930505A04Rik T C 11: 30,426,169 T233A probably damaging Het
Ankar T C 1: 72,658,414 I859V probably benign Het
Cacnb2 G T 2: 14,986,038 A644S possibly damaging Het
Gatb T C 3: 85,636,931 V402A probably benign Het
Gpcpd1 T C 2: 132,553,972 K153R probably damaging Het
Hip1 A G 5: 135,434,293 L60S probably damaging Het
Hsf4 GCAGCACCGGGTCA G 8: 105,271,428 probably null Het
Hydin A T 8: 110,413,211 probably null Het
Igsf3 A T 3: 101,431,527 T386S possibly damaging Het
Kank1 T C 19: 25,424,181 S1051P probably damaging Het
Kap A G 6: 133,851,916 probably null Het
Ly96 A G 1: 16,700,867 E74G probably damaging Het
Map7d1 G T 4: 126,242,304 probably null Het
Megf6 G T 4: 154,252,523 R253L probably benign Het
Mex3b A G 7: 82,869,251 D258G probably damaging Het
Mpzl3 T C 9: 45,062,110 I49T possibly damaging Het
Myh15 C A 16: 49,101,507 T472N probably benign Het
Nacad A G 11: 6,601,611 S527P probably damaging Het
Nkx2-3 T G 19: 43,612,708 S70A probably benign Het
Nkx2-6 A T 14: 69,171,893 Q31L probably benign Het
Olfr522 A G 7: 140,162,719 V77A probably damaging Het
Pcdha6 A T 18: 36,968,791 N346Y probably damaging Het
Pkd2 G A 5: 104,459,919 D95N probably benign Het
Pkhd1l1 A G 15: 44,547,148 T2684A probably damaging Het
Plin2 A G 4: 86,657,146 Y389H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc41a2 T C 10: 83,313,411 probably null Het
Smg6 A G 11: 75,041,996 T1038A probably damaging Het
Suds3 T C 5: 117,100,599 probably benign Het
Tbc1d8 T C 1: 39,385,132 H626R probably benign Het
Tmem260 T A 14: 48,509,116 H616Q probably benign Het
Trip10 A T 17: 57,261,288 probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubr4 A G 4: 139,410,649 T1106A probably benign Het
Vmn1r84 A T 7: 12,362,458 S103T probably benign Het
Vps13a G T 19: 16,685,315 P1602Q probably damaging Het
Other mutations in Il12rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02056:Il12rb1 APN 8 70811187 nonsense probably null
IGL03065:Il12rb1 APN 8 70820558 missense possibly damaging 0.51
P0026:Il12rb1 UTSW 8 70812541 missense probably damaging 0.99
R0140:Il12rb1 UTSW 8 70819771 splice site probably benign
R0763:Il12rb1 UTSW 8 70813290 splice site probably benign
R1554:Il12rb1 UTSW 8 70813372 critical splice donor site probably null
R1577:Il12rb1 UTSW 8 70810606 missense probably damaging 0.99
R1688:Il12rb1 UTSW 8 70819402 missense probably damaging 1.00
R1918:Il12rb1 UTSW 8 70813680 missense probably benign 0.04
R2848:Il12rb1 UTSW 8 70815802 nonsense probably null
R3735:Il12rb1 UTSW 8 70817218 missense probably damaging 0.99
R4791:Il12rb1 UTSW 8 70813368 missense possibly damaging 0.83
R4857:Il12rb1 UTSW 8 70810588 missense possibly damaging 0.94
R5493:Il12rb1 UTSW 8 70809839 missense probably benign 0.00
R5590:Il12rb1 UTSW 8 70813767 missense possibly damaging 0.83
R6484:Il12rb1 UTSW 8 70809704 unclassified probably null
R7213:Il12rb1 UTSW 8 70816453 missense probably benign 0.00
R7301:Il12rb1 UTSW 8 70813699 missense possibly damaging 0.73
R7388:Il12rb1 UTSW 8 70810627 missense probably damaging 1.00
X0061:Il12rb1 UTSW 8 70814635 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCAAGGGACAGACAGTCTAG -3'
(R):5'- ACTCACTCCAGTTGTACAGGTAC -3'

Sequencing Primer
(F):5'- CAAGGGACAGACAGTCTAGTTTCTC -3'
(R):5'- ACTGGGATATCTTCTGGGACTTC -3'
Posted On2016-07-22