Incidental Mutation 'R5418:Crlf2'
ID427838
Institutional Source Beutler Lab
Gene Symbol Crlf2
Ensembl Gene ENSMUSG00000033467
Gene Namecytokine receptor-like factor 2
SynonymsLy114, Tpte2, Tslpr
MMRRC Submission 042986-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.494) question?
Stock #R5418 (G1)
Quality Score211
Status Validated
Chromosome5
Chromosomal Location109554709-109558993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109557033 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 104 (V104A)
Ref Sequence ENSEMBL: ENSMUSP00000036326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044579] [ENSMUST00000198960] [ENSMUST00000200284]
Predicted Effect probably benign
Transcript: ENSMUST00000044579
AA Change: V104A

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036326
Gene: ENSMUSG00000033467
AA Change: V104A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 84 102 N/A INTRINSIC
FN3 117 196 2.58e-4 SMART
low complexity region 210 253 N/A INTRINSIC
low complexity region 335 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196881
Predicted Effect probably benign
Transcript: ENSMUST00000198960
SMART Domains Protein: ENSMUSP00000142982
Gene: ENSMUSG00000033467

DomainStartEndE-ValueType
Blast:FN3 1 52 2e-30 BLAST
SCOP:d1eerb2 1 65 7e-8 SMART
PDB:4NN7|C 1 66 2e-41 PDB
transmembrane domain 95 117 N/A INTRINSIC
low complexity region 202 214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200284
AA Change: V102A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143641
Gene: ENSMUSG00000033467
AA Change: V102A

DomainStartEndE-ValueType
low complexity region 82 100 N/A INTRINSIC
FN3 115 194 1.3e-6 SMART
low complexity region 208 251 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I cytokine receptor family. The encoded protein is a receptor for thymic stromal lymphopoietin (TSLP). Together with the interleukin 7 receptor (IL7R), the encoded protein and TSLP activate STAT3, STAT5, and JAK2 pathways, which control processes such as cell proliferation and development of the hematopoietic system. Rearrangement of this gene with immunoglobulin heavy chain gene (IGH) on chromosome 14, or with P2Y purinoceptor 8 gene (P2RY8) on the same X or Y chromosomes is associated with B-progenitor acute lymphoblastic leukemia (ALL) and Down syndrome ALL. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice are overtly normal and maintain normal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,136 Y227H probably damaging Het
4930568D16Rik A G 2: 35,354,726 S205P probably damaging Het
9530077C05Rik G T 9: 22,431,770 R187L probably damaging Het
Abcc1 T C 16: 14,461,132 V1102A probably benign Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Acoxl T A 2: 127,877,802 M161K probably benign Het
Adamts4 T A 1: 171,252,574 V35E probably damaging Het
Add2 A G 6: 86,110,912 S614G probably benign Het
Adgrv1 T A 13: 81,419,308 I5249L probably benign Het
Agps A G 2: 75,858,904 T252A probably damaging Het
Alms1-ps1 G A 6: 85,755,602 noncoding transcript Het
Ankrd24 T A 10: 81,644,942 probably benign Het
Bcl9l A G 9: 44,505,436 Q218R possibly damaging Het
Bin2 T C 15: 100,649,146 Y232C probably damaging Het
Bptf A G 11: 107,111,294 Y331H probably damaging Het
Ccr10 C T 11: 101,174,078 V209M probably benign Het
Cflar A T 1: 58,752,651 D371V possibly damaging Het
Col1a2 A G 6: 4,516,931 probably benign Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dmxl2 A G 9: 54,374,651 probably null Het
Dnah17 C A 11: 118,094,984 E1422D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Efcab11 A G 12: 99,855,618 L80S possibly damaging Het
Emc8 G A 8: 120,658,603 T130M probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Erc2 A G 14: 27,966,510 M196V probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fam120b C T 17: 15,401,799 T13M probably damaging Het
Fam234b A G 6: 135,226,968 K423E probably benign Het
Fcgbp G A 7: 28,085,313 G266D probably damaging Het
Fndc4 A T 5: 31,294,634 S146R probably benign Het
Frmd3 G A 4: 74,161,698 probably null Het
Glrx2 C A 1: 143,739,708 S16R possibly damaging Het
Gm26526 T G 7: 39,588,934 noncoding transcript Het
Hc C T 2: 35,008,183 probably null Het
Herc2 T C 7: 56,137,565 C1695R probably damaging Het
Hic1 A G 11: 75,166,599 probably null Het
Igkv4-92 A T 6: 68,755,580 V5E possibly damaging Het
Irs1 G A 1: 82,288,770 T575I probably damaging Het
Kcp A T 6: 29,504,284 Y143* probably null Het
Klb A G 5: 65,383,470 N969D probably benign Het
Klra6 T A 6: 130,013,430 L239F probably damaging Het
Lhx6 A G 2: 36,087,366 probably null Het
Lrrc34 G A 3: 30,642,774 P116S possibly damaging Het
Map3k9 T A 12: 81,743,817 K321* probably null Het
Mapk14 T C 17: 28,741,843 V196A possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mtmr12 T C 15: 12,269,959 L711P probably damaging Het
Mylk T C 16: 34,912,230 S627P probably benign Het
Nbea A T 3: 55,645,989 Y2631N possibly damaging Het
Ncoa7 A G 10: 30,648,039 V153A probably damaging Het
Olfr1252 T C 2: 89,721,999 I37M probably benign Het
Pax6 A T 2: 105,691,565 D175V probably benign Het
Piezo1 A G 8: 122,486,780 L1793P probably damaging Het
Pkp4 T C 2: 59,310,162 V404A probably benign Het
Plxnb2 A G 15: 89,166,491 Y421H probably benign Het
Prkdc T G 16: 15,795,097 V3173G probably benign Het
Prss40 A T 1: 34,560,759 I49N probably benign Het
Prx T A 7: 27,517,274 V400E probably damaging Het
Rbm11 A C 16: 75,596,535 T40P probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sema3f A G 9: 107,692,621 Y70H probably damaging Het
Senp6 G A 9: 80,121,869 E505K possibly damaging Het
Slc25a3 T C 10: 91,119,536 I147M probably benign Het
Slc4a7 T A 14: 14,760,280 S572T probably benign Het
Smarcal1 C T 1: 72,598,909 P501S probably benign Het
Sox7 C T 14: 63,947,947 T144M probably benign Het
Taar1 T C 10: 23,921,316 F304S possibly damaging Het
Tcf3 A G 10: 80,427,683 F46L probably damaging Het
Tmem184c A G 8: 77,597,820 V347A probably damaging Het
Tpcn2 C T 7: 145,278,781 E113K probably damaging Het
Vmn1r232 T A 17: 20,914,116 Y74F possibly damaging Het
Vmn2r102 C T 17: 19,694,153 T660I probably damaging Het
Zdhhc3 A G 9: 123,080,391 M234T probably damaging Het
Zfp960 T A 17: 17,087,543 L173H probably damaging Het
Other mutations in Crlf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Crlf2 APN 5 109557570 missense possibly damaging 0.66
R0623:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0623:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0732:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R0898:Crlf2 UTSW 5 109557138 missense probably damaging 0.99
R1277:Crlf2 UTSW 5 109557600 missense possibly damaging 0.46
R1674:Crlf2 UTSW 5 109558803 critical splice donor site probably null
R1912:Crlf2 UTSW 5 109557141 missense possibly damaging 0.83
R5276:Crlf2 UTSW 5 109557635 unclassified probably benign
R5984:Crlf2 UTSW 5 109555603 missense probably damaging 1.00
R6848:Crlf2 UTSW 5 109557031 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTCCGGTATCAAAGACCAACTTC -3'
(R):5'- AATTCAGATGCTCGTGGGCG -3'

Sequencing Primer
(F):5'- AACTTCCCGTCTAAGCGCCG -3'
(R):5'- GGTCCATCACTTCCCATCCAG -3'
Posted On2016-09-01