Incidental Mutation 'R5418:Klra6'
ID427844
Institutional Source Beutler Lab
Gene Symbol Klra6
Ensembl Gene ENSMUSG00000061769
Gene Namekiller cell lectin-like receptor, subfamily A, member 6
SynonymsLy49F, Ly49f
MMRRC Submission 042986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.027) question?
Stock #R5418 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130013033-130026954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130013430 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 239 (L239F)
Ref Sequence ENSEMBL: ENSMUSP00000073700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074056]
Predicted Effect probably damaging
Transcript: ENSMUST00000074056
AA Change: L239F

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073700
Gene: ENSMUSG00000061769
AA Change: L239F

DomainStartEndE-ValueType
Blast:CLECT 73 123 3e-9 BLAST
CLECT 143 258 8.42e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157801
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: This gene belongs to the highly polymorphic family of C-type lectin-like Ly49 genes that are expressed in natural killer (NK) cells. The encoded protein is a homodimeric type II transmembrane receptor located at the cell surface and inhibits NK cell activation upon ligand binding. This gene is located in a cluster of several Klra paralogs on chromosome 6. Different strains of mice show variation in the number of paralogs, including strain specific duplications, deletions and pseudogene sequences. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,136 Y227H probably damaging Het
4930568D16Rik A G 2: 35,354,726 S205P probably damaging Het
9530077C05Rik G T 9: 22,431,770 R187L probably damaging Het
Abcc1 T C 16: 14,461,132 V1102A probably benign Het
Acad8 A T 9: 26,985,557 M202K probably damaging Het
Acoxl T A 2: 127,877,802 M161K probably benign Het
Adamts4 T A 1: 171,252,574 V35E probably damaging Het
Add2 A G 6: 86,110,912 S614G probably benign Het
Adgrv1 T A 13: 81,419,308 I5249L probably benign Het
Agps A G 2: 75,858,904 T252A probably damaging Het
Alms1-ps1 G A 6: 85,755,602 noncoding transcript Het
Ankrd24 T A 10: 81,644,942 probably benign Het
Bcl9l A G 9: 44,505,436 Q218R possibly damaging Het
Bin2 T C 15: 100,649,146 Y232C probably damaging Het
Bptf A G 11: 107,111,294 Y331H probably damaging Het
Ccr10 C T 11: 101,174,078 V209M probably benign Het
Cflar A T 1: 58,752,651 D371V possibly damaging Het
Col1a2 A G 6: 4,516,931 probably benign Het
Crlf2 A G 5: 109,557,033 V104A probably benign Het
Dennd1c CCGCCCCTCGCTGACAGC CC 17: 57,066,755 probably null Het
Dmxl2 A G 9: 54,374,651 probably null Het
Dnah17 C A 11: 118,094,984 E1422D probably benign Het
Dnase1l1 C T X: 74,277,038 probably null Het
Efcab11 A G 12: 99,855,618 L80S possibly damaging Het
Emc8 G A 8: 120,658,603 T130M probably damaging Het
Epha6 C A 16: 60,424,835 A334S possibly damaging Het
Erc2 A G 14: 27,966,510 M196V probably benign Het
Etnk2 T C 1: 133,373,257 I254T probably damaging Het
Fam120b C T 17: 15,401,799 T13M probably damaging Het
Fam234b A G 6: 135,226,968 K423E probably benign Het
Fcgbp G A 7: 28,085,313 G266D probably damaging Het
Fndc4 A T 5: 31,294,634 S146R probably benign Het
Frmd3 G A 4: 74,161,698 probably null Het
Glrx2 C A 1: 143,739,708 S16R possibly damaging Het
Gm26526 T G 7: 39,588,934 noncoding transcript Het
Hc C T 2: 35,008,183 probably null Het
Herc2 T C 7: 56,137,565 C1695R probably damaging Het
Hic1 A G 11: 75,166,599 probably null Het
Igkv4-92 A T 6: 68,755,580 V5E possibly damaging Het
Irs1 G A 1: 82,288,770 T575I probably damaging Het
Kcp A T 6: 29,504,284 Y143* probably null Het
Klb A G 5: 65,383,470 N969D probably benign Het
Lhx6 A G 2: 36,087,366 probably null Het
Lrrc34 G A 3: 30,642,774 P116S possibly damaging Het
Map3k9 T A 12: 81,743,817 K321* probably null Het
Mapk14 T C 17: 28,741,843 V196A possibly damaging Het
Mmp1b T C 9: 7,384,897 I251V possibly damaging Het
Mtmr12 T C 15: 12,269,959 L711P probably damaging Het
Mylk T C 16: 34,912,230 S627P probably benign Het
Nbea A T 3: 55,645,989 Y2631N possibly damaging Het
Ncoa7 A G 10: 30,648,039 V153A probably damaging Het
Olfr1252 T C 2: 89,721,999 I37M probably benign Het
Pax6 A T 2: 105,691,565 D175V probably benign Het
Piezo1 A G 8: 122,486,780 L1793P probably damaging Het
Pkp4 T C 2: 59,310,162 V404A probably benign Het
Plxnb2 A G 15: 89,166,491 Y421H probably benign Het
Prkdc T G 16: 15,795,097 V3173G probably benign Het
Prss40 A T 1: 34,560,759 I49N probably benign Het
Prx T A 7: 27,517,274 V400E probably damaging Het
Rbm11 A C 16: 75,596,535 T40P probably damaging Het
Scara5 CG C 14: 65,759,662 probably null Het
Sema3f A G 9: 107,692,621 Y70H probably damaging Het
Senp6 G A 9: 80,121,869 E505K possibly damaging Het
Slc25a3 T C 10: 91,119,536 I147M probably benign Het
Slc4a7 T A 14: 14,760,280 S572T probably benign Het
Smarcal1 C T 1: 72,598,909 P501S probably benign Het
Sox7 C T 14: 63,947,947 T144M probably benign Het
Taar1 T C 10: 23,921,316 F304S possibly damaging Het
Tcf3 A G 10: 80,427,683 F46L probably damaging Het
Tmem184c A G 8: 77,597,820 V347A probably damaging Het
Tpcn2 C T 7: 145,278,781 E113K probably damaging Het
Vmn1r232 T A 17: 20,914,116 Y74F possibly damaging Het
Vmn2r102 C T 17: 19,694,153 T660I probably damaging Het
Zdhhc3 A G 9: 123,080,391 M234T probably damaging Het
Zfp960 T A 17: 17,087,543 L173H probably damaging Het
Other mutations in Klra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Klra6 APN 6 130023700 missense possibly damaging 0.77
IGL02037:Klra6 APN 6 130013476 missense probably benign 0.02
IGL02319:Klra6 APN 6 130025214 missense probably damaging 0.98
IGL02427:Klra6 APN 6 130016717 missense possibly damaging 0.54
IGL02730:Klra6 APN 6 130022697 missense probably benign
IGL02822:Klra6 APN 6 130016710 nonsense probably null
R0485:Klra6 UTSW 6 130023638 missense probably benign 0.12
R0697:Klra6 UTSW 6 130016724 missense probably benign 0.18
R0731:Klra6 UTSW 6 130022705 missense probably damaging 1.00
R1081:Klra6 UTSW 6 130022625 missense probably damaging 0.96
R1708:Klra6 UTSW 6 130022714 nonsense probably null
R1749:Klra6 UTSW 6 130018952 missense probably damaging 1.00
R1842:Klra6 UTSW 6 130022610 missense probably benign 0.14
R1944:Klra6 UTSW 6 130018945 missense possibly damaging 0.92
R4214:Klra6 UTSW 6 130018922 missense probably benign 0.10
R5210:Klra6 UTSW 6 130018892 nonsense probably null
R5286:Klra6 UTSW 6 130018969 missense probably benign 0.02
R5764:Klra6 UTSW 6 130022729 missense possibly damaging 0.92
R6193:Klra6 UTSW 6 130018918 missense probably benign 0.12
R6536:Klra6 UTSW 6 130023719 missense probably benign 0.07
R6696:Klra6 UTSW 6 130016733 missense probably benign
R7021:Klra6 UTSW 6 130018858 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCACAGCAGTCTATGTTCTGTAATC -3'
(R):5'- GGTGTGATAAGAGACCATTTCTTTG -3'

Sequencing Primer
(F):5'- CCTTTAACTTTGGTGGAAAG -3'
(R):5'- CGTGATGATCTTAGGCTTC -3'
Posted On2016-09-01