Incidental Mutation 'R5439:Egflam'
ID428549
Institutional Source Beutler Lab
Gene Symbol Egflam
Ensembl Gene ENSMUSG00000042961
Gene NameEGF-like, fibronectin type III and laminin G domains
Synonymsnectican, pikachurin
MMRRC Submission 043004-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5439 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location7206120-7398395 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 7224663 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 824 (G824R)
Ref Sequence ENSEMBL: ENSMUSP00000094238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058593] [ENSMUST00000096494] [ENSMUST00000160207]
Predicted Effect probably benign
Transcript: ENSMUST00000058593
SMART Domains Protein: ENSMUSP00000055599
Gene: ENSMUSG00000042961

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 852 988 1.47e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000096494
AA Change: G824R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000094238
Gene: ENSMUSG00000042961
AA Change: G824R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FN3 35 123 4.52e-9 SMART
FN3 142 225 1.89e-11 SMART
low complexity region 256 273 N/A INTRINSIC
EGF_like 346 381 4.28e1 SMART
LamG 407 543 1.04e-34 SMART
EGF 563 602 3.48e-5 SMART
LamG 633 767 1.55e-33 SMART
EGF 787 820 4.35e-6 SMART
LamG 860 996 1.47e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160314
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile under normal conditions. They exhibit abnormal photoreceptor ribbon synapses, resulting in alteration in synaptic signal transmission and visual function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C A 4: 53,042,381 R1897L possibly damaging Het
Ablim2 A G 5: 35,857,826 K461E probably damaging Het
Acss3 A T 10: 106,937,147 Y659* probably null Het
Actr8 T G 14: 29,986,995 L253R probably damaging Het
Arid4b A G 13: 14,187,696 K915R probably damaging Het
C3 T C 17: 57,204,502 E1560G probably benign Het
Cacna1c A T 6: 118,654,372 I1013N probably damaging Het
Cep83 G A 10: 94,789,738 R670H probably benign Het
Col19a1 T A 1: 24,293,112 D870V probably damaging Het
Ddr2 A G 1: 170,004,729 V164A possibly damaging Het
Donson A T 16: 91,679,926 V549E probably damaging Het
Extl3 A G 14: 65,054,626 F916S probably damaging Het
Fam110c A G 12: 31,074,407 M123V unknown Het
G3bp1 A T 11: 55,497,987 I342F probably damaging Het
Gm438 A T 4: 144,778,113 I156N probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hspb1 A T 5: 135,889,332 T178S probably benign Het
Iigp1 A G 18: 60,390,257 Y149C probably damaging Het
Il22 G T 10: 118,209,461 G159* probably null Het
Jcad T C 18: 4,675,790 F1184S probably damaging Het
Kcnj2 G T 11: 111,072,231 V150L probably damaging Het
Kifc1 C T 17: 33,886,665 R56Q probably damaging Het
Lce1h A G 3: 92,763,720 S42P unknown Het
Lrp4 C A 2: 91,497,073 D1471E probably benign Het
Lrrc3 C A 10: 77,901,465 V46L probably benign Het
Mcf2l G A 8: 12,926,646 A2T possibly damaging Het
Med12l G A 3: 59,263,213 C1673Y probably null Het
Nckap1 T C 2: 80,512,690 E955G possibly damaging Het
Ndufs3 T A 2: 90,902,346 probably null Het
Nkx6-1 A G 5: 101,661,832 probably null Het
Obscn C A 11: 59,000,128 E1713* probably null Het
Olfr1335 G A 4: 118,809,363 T167I possibly damaging Het
Olfr134 T A 17: 38,176,026 probably null Het
Olfr148 A G 9: 39,613,620 T18A probably benign Het
Olfr1511 A G 14: 52,390,125 F216S probably damaging Het
Olfr429 A G 1: 174,089,975 R312G probably benign Het
Olfr58 A C 9: 19,783,865 H244P probably damaging Het
Olfr893 A G 9: 38,209,754 T234A probably benign Het
Osbpl5 A G 7: 143,741,696 F10L possibly damaging Het
Plvap A C 8: 71,511,451 I89S probably damaging Het
Ppp2r2a A G 14: 67,022,323 V308A possibly damaging Het
Ppp2r5e T C 12: 75,493,476 S132G probably benign Het
Pum3 G T 19: 27,412,259 Q398K probably benign Het
Ralgapa2 T C 2: 146,342,510 T1526A probably benign Het
Sh3tc2 T A 18: 61,989,633 Y488* probably null Het
Spata48 A T 11: 11,490,244 R8S possibly damaging Het
Sqle A G 15: 59,330,904 Y537C probably benign Het
Sult2a8 T G 7: 14,425,514 K60T probably damaging Het
Tex15 T C 8: 33,574,171 S1210P possibly damaging Het
Thumpd3 A G 6: 113,066,864 silent Het
Timeless A G 10: 128,241,735 D228G probably damaging Het
Trim31 A T 17: 36,905,905 probably null Het
Ttc39c A T 18: 12,695,371 D196V possibly damaging Het
Wbp4 C A 14: 79,472,397 V133L possibly damaging Het
Wdr92 A G 11: 17,212,031 D23G possibly damaging Het
Zfp354c G T 11: 50,815,770 D159E probably benign Het
Zfp940 C A 7: 29,845,433 D350Y probably benign Het
Other mutations in Egflam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Egflam APN 15 7219764 missense probably damaging 1.00
IGL02352:Egflam APN 15 7234225 missense probably benign 0.01
IGL02359:Egflam APN 15 7234225 missense probably benign 0.01
IGL02389:Egflam APN 15 7250078 missense probably benign 0.01
IGL02400:Egflam APN 15 7247053 missense probably benign 0.00
IGL02530:Egflam APN 15 7222812 missense probably damaging 1.00
IGL02892:Egflam APN 15 7289796 missense probably benign
R0047:Egflam UTSW 15 7253430 missense possibly damaging 0.56
R0047:Egflam UTSW 15 7253430 missense possibly damaging 0.56
R0345:Egflam UTSW 15 7289994 intron probably null
R0504:Egflam UTSW 15 7222758 missense probably damaging 1.00
R0532:Egflam UTSW 15 7234237 missense probably benign 0.19
R0573:Egflam UTSW 15 7242425 nonsense probably null
R0609:Egflam UTSW 15 7253523 missense possibly damaging 0.65
R0648:Egflam UTSW 15 7207709 missense probably damaging 1.00
R0653:Egflam UTSW 15 7250028 critical splice donor site probably null
R1099:Egflam UTSW 15 7252422 missense probably benign 0.00
R1711:Egflam UTSW 15 7289915 missense possibly damaging 0.85
R1842:Egflam UTSW 15 7303941 missense probably benign 0.00
R1964:Egflam UTSW 15 7247105 missense probably damaging 0.97
R2001:Egflam UTSW 15 7242567 missense probably benign 0.18
R2008:Egflam UTSW 15 7237804 missense possibly damaging 0.95
R2134:Egflam UTSW 15 7234279 missense probably damaging 0.97
R2852:Egflam UTSW 15 7219701 missense probably damaging 1.00
R2853:Egflam UTSW 15 7219701 missense probably damaging 1.00
R4257:Egflam UTSW 15 7254426 splice site probably null
R4346:Egflam UTSW 15 7234278 nonsense probably null
R4380:Egflam UTSW 15 7243869 missense possibly damaging 0.70
R4538:Egflam UTSW 15 7252437 missense probably damaging 1.00
R4746:Egflam UTSW 15 7224639 splice site probably null
R4909:Egflam UTSW 15 7219629 missense probably damaging 1.00
R5027:Egflam UTSW 15 7253644 missense probably benign 0.00
R5314:Egflam UTSW 15 7304012 missense probably damaging 1.00
R5495:Egflam UTSW 15 7251241 missense probably damaging 1.00
R5626:Egflam UTSW 15 7251207 missense possibly damaging 0.89
R5931:Egflam UTSW 15 7243857 missense possibly damaging 0.49
R5977:Egflam UTSW 15 7318245 missense possibly damaging 0.94
R6258:Egflam UTSW 15 7234292 missense probably damaging 0.98
R6395:Egflam UTSW 15 7231695 missense probably damaging 1.00
R6497:Egflam UTSW 15 7251303 splice site probably null
R6736:Egflam UTSW 15 7219725 missense probably damaging 1.00
X0024:Egflam UTSW 15 7304013 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGATTCTAGTCTAGCTGCCTGC -3'
(R):5'- AAATGGCCAGGGCTTCTTGC -3'

Sequencing Primer
(F):5'- CAGTACTTGCCAGCTTGGGTAC -3'
(R):5'- GCTTCTTGCCACAGCCTG -3'
Posted On2016-09-01