Incidental Mutation 'R5501:Olfr849'
ID430618
Institutional Source Beutler Lab
Gene Symbol Olfr849
Ensembl Gene ENSMUSG00000052182
Gene Nameolfactory receptor 849
SynonymsMOR151-1, GA_x6K02T2PVTD-13176842-13177780
MMRRC Submission 043062-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R5501 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location19440266-19446923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 19440994 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 27 (I27N)
Ref Sequence ENSEMBL: ENSMUSP00000149769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063923] [ENSMUST00000217273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063923
AA Change: I27N

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064123
Gene: ENSMUSG00000052182
AA Change: I27N

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.6e-6 PFAM
Pfam:7tm_1 41 290 2.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157237
Predicted Effect possibly damaging
Transcript: ENSMUST00000217273
AA Change: I27N

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26a A C 8: 43,569,904 L183* probably null Het
Alox12e G T 11: 70,316,229 Q584K probably benign Het
Atp1a4 A G 1: 172,246,832 S285P probably damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Col25a1 A G 3: 130,595,663 T632A probably benign Het
Coro6 T C 11: 77,467,796 F227S probably damaging Het
Diras2 C T 13: 52,507,750 V174M probably benign Het
Dopey1 A G 9: 86,507,730 D569G probably benign Het
Dync1li2 A G 8: 104,440,472 probably null Het
Dysf T C 6: 84,087,818 V508A probably damaging Het
Edem1 T C 6: 108,843,100 probably null Het
Eef2k A G 7: 120,889,248 D452G probably benign Het
Espl1 A G 15: 102,317,130 R1539G possibly damaging Het
Fat4 A G 3: 38,887,215 S86G probably benign Het
Hpgd A T 8: 56,298,356 D73V probably benign Het
Ltb4r1 A G 14: 55,768,082 N281D probably damaging Het
Map7 T C 10: 20,276,202 S638P unknown Het
Mical1 G A 10: 41,486,079 A934T probably benign Het
Micu3 C A 8: 40,354,300 probably null Het
Mmp24 T A 2: 155,798,136 Y129N probably damaging Het
Mras A T 9: 99,411,546 Y14N probably damaging Het
Msmo1 A T 8: 64,722,489 I169N probably damaging Het
Mtrr G T 13: 68,579,647 T60K probably damaging Het
Olfr1218 A T 2: 89,054,886 L180* probably null Het
Olfr478 G T 7: 108,032,153 Y63* probably null Het
Pam A T 1: 97,840,365 C8* probably null Het
Phrf1 T G 7: 141,259,921 S1169A possibly damaging Het
Pkd1l2 T C 8: 117,065,830 T408A probably damaging Het
Plch1 G T 3: 63,707,741 Q778K probably damaging Het
Ppp1r3a A G 6: 14,719,418 V499A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ryr3 C A 2: 112,662,504 S3736I possibly damaging Het
Serpinb13 T C 1: 106,982,185 F11L possibly damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Smcp A G 3: 92,584,424 C39R unknown Het
Sox9 T A 11: 112,783,859 L161Q probably damaging Het
Tanc2 T C 11: 105,914,985 probably null Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tmem131l G T 3: 83,926,128 N809K probably damaging Het
Tyk2 T C 9: 21,121,612 Y285C probably damaging Het
Usp15 T A 10: 123,175,899 N98Y probably damaging Het
Other mutations in Olfr849
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfr849 APN 9 19440970 missense probably benign 0.01
IGL01599:Olfr849 APN 9 19441815 missense probably benign 0.00
IGL01885:Olfr849 APN 9 19441464 missense probably benign 0.01
IGL02258:Olfr849 APN 9 19440997 missense possibly damaging 0.66
IGL02258:Olfr849 APN 9 19440999 missense probably benign 0.00
IGL02282:Olfr849 APN 9 19441618 missense probably benign 0.42
R1293:Olfr849 UTSW 9 19441432 missense probably benign 0.27
R1931:Olfr849 UTSW 9 19441351 missense possibly damaging 0.93
R2444:Olfr849 UTSW 9 19441015 missense possibly damaging 0.78
R4181:Olfr849 UTSW 9 19441735 missense possibly damaging 0.86
R4231:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4233:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4236:Olfr849 UTSW 9 19441590 missense probably damaging 1.00
R4302:Olfr849 UTSW 9 19440999 missense probably benign 0.00
R4651:Olfr849 UTSW 9 19441295 nonsense probably null
R5006:Olfr849 UTSW 9 19441249 missense probably benign 0.30
R5088:Olfr849 UTSW 9 19441771 missense probably damaging 1.00
R6775:Olfr849 UTSW 9 19441422 missense possibly damaging 0.56
R7038:Olfr849 UTSW 9 19441592 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTCCCTGTCAAACAAAACAGTG -3'
(R):5'- GGTGTGATCCTCCCTCTGAATG -3'

Sequencing Primer
(F):5'- CCATGATGTTTACTATGAAACCTTGC -3'
(R):5'- TCCCTCTGAATGTTCACCAAC -3'
Posted On2016-10-05