Incidental Mutation 'R5569:Inf2'
ID435559
Institutional Source Beutler Lab
Gene Symbol Inf2
Ensembl Gene ENSMUSG00000037679
Gene Nameinverted formin, FH2 and WH2 domain containing
Synonyms2610204M08Rik, EG629699
MMRRC Submission 043126-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5569 (G1)
Quality Score167
Status Not validated
Chromosome12
Chromosomal Location112588784-112615557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112601679 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 222 (I222V)
Ref Sequence ENSEMBL: ENSMUSP00000098591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101029] [ENSMUST00000220786]
Predicted Effect possibly damaging
Transcript: ENSMUST00000101029
AA Change: I222V

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098591
Gene: ENSMUSG00000037679
AA Change: I222V

DomainStartEndE-ValueType
Drf_GBD 1 152 3.47e-34 SMART
Drf_FH3 156 343 2.18e-58 SMART
low complexity region 359 382 N/A INTRINSIC
low complexity region 420 518 N/A INTRINSIC
low complexity region 525 557 N/A INTRINSIC
FH2 587 1030 1.96e-53 SMART
WH2 1005 1020 1.68e-2 SMART
Blast:FH2 1049 1179 3e-28 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000220786
Predicted Effect probably benign
Transcript: ENSMUST00000222275
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a member of the formin family of proteins. It is considered a diaphanous formin due to the presence of a diaphanous inhibitory domain located at the N-terminus of the encoded protein. Studies of a similar mouse protein indicate that the protein encoded by this locus may function in polymerization and depolymerization of actin filaments. Mutations at this locus have been associated with focal segmental glomerulosclerosis 5.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele display placental vasculopathy, restricted fetal growth, increased gestational length and transient increase in maternal blood pressure in the late stages of pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A G 5: 121,626,080 S929P probably damaging Het
Ackr3 A G 1: 90,214,841 T341A probably benign Het
Acox3 A G 5: 35,603,033 Y431C probably damaging Het
Adamtsl2 G A 2: 27,102,833 V653M probably damaging Het
Anks6 T C 4: 47,045,007 K300E probably damaging Het
Ap5z1 A T 5: 142,474,451 D495V probably damaging Het
Atm A T 9: 53,516,450 Y453* probably null Het
Atpaf2 A T 11: 60,416,880 W11R probably damaging Het
Capn1 T A 19: 6,013,660 T129S probably benign Het
Cdh17 A G 4: 11,816,990 I800M probably damaging Het
Cfap206 C T 4: 34,724,892 R69Q probably damaging Het
Cp T C 3: 19,978,877 Y623H probably damaging Het
Dcaf5 A T 12: 80,340,201 Y384N probably damaging Het
Dhx9 A T 1: 153,467,092 C555S possibly damaging Het
Dlg2 A G 7: 91,968,180 T317A probably benign Het
Dsp C T 13: 38,192,652 T1471I probably benign Het
Ebf1 A G 11: 44,992,401 M489V possibly damaging Het
Enpp3 T C 10: 24,778,821 D230G probably damaging Het
Eri3 T C 4: 117,649,356 M294T possibly damaging Het
Fat1 T A 8: 45,039,836 V3842E probably damaging Het
Fermt1 T A 2: 132,915,203 Y569F possibly damaging Het
Fscn1 A G 5: 142,961,044 D199G probably benign Het
Glce A G 9: 62,070,203 V133A probably benign Het
Gm10020 T C 15: 52,478,228 noncoding transcript Het
Gm16432 A T 1: 178,111,596 K678N possibly damaging Het
Gm5096 A C 18: 87,757,268 Y305S probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Hk1 A G 10: 62,286,441 S520P probably benign Het
Ighv12-3 A G 12: 114,366,935 V7A probably benign Het
Ighv6-7 C A 12: 114,455,856 A43S probably damaging Het
Kmo T A 1: 175,655,122 N337K probably benign Het
Mcf2l C T 8: 13,005,481 R611W probably damaging Het
Mipep A T 14: 60,802,934 H301L probably damaging Het
Mprip A T 11: 59,760,963 E1831V probably damaging Het
Mrgpra3 T C 7: 47,590,011 T56A probably benign Het
Mtmr14 G A 6: 113,240,285 V53I probably damaging Het
Mycbp2 A T 14: 103,135,243 W4056R probably damaging Het
Myl2 A T 5: 122,106,720 D151V possibly damaging Het
Myo5c A T 9: 75,273,510 D727V probably damaging Het
Olfr381 A T 11: 73,486,692 I44N probably damaging Het
Olfr466 A G 13: 65,152,979 T252A possibly damaging Het
Olfr504 T A 7: 108,565,565 M77L probably benign Het
Olfr693 A T 7: 106,678,483 M1K probably null Het
Olfr982 A G 9: 40,074,297 M1V probably null Het
Pabpc1l C T 2: 164,043,554 T409I probably benign Het
Pcgf1 C T 6: 83,079,705 R81* probably null Het
Pcgf2 A G 11: 97,692,367 probably null Het
Phf14 T A 6: 11,934,016 N292K probably damaging Het
Plin4 T C 17: 56,102,147 T1358A probably benign Het
Pomgnt1 T C 4: 116,155,967 S423P probably damaging Het
Pqlc3 T A 12: 16,995,628 I114F possibly damaging Het
Prep G A 10: 45,097,437 V214I probably benign Het
Ptger1 T C 8: 83,668,332 probably null Het
Pus7 C T 5: 23,748,834 G415D probably benign Het
Rbm44 C T 1: 91,168,738 P940S probably damaging Het
Ripor1 A T 8: 105,617,515 D427V probably damaging Het
Rp1 A G 1: 4,345,237 I1884T probably damaging Het
Serinc2 T C 4: 130,278,479 R7G probably benign Het
Serpina6 A C 12: 103,654,460 F10C possibly damaging Het
Skint5 T A 4: 113,688,706 probably null Het
Slc6a4 A T 11: 77,023,255 I544F possibly damaging Het
Spdye4b T C 5: 143,202,421 M223T probably benign Het
Tbc1d17 A T 7: 44,848,331 V39D probably damaging Het
Thbs3 T A 3: 89,219,463 Y295N probably damaging Het
Themis G A 10: 28,781,891 E152K possibly damaging Het
Tmem131 A T 1: 36,799,338 I1502N probably benign Het
Tmem43 T A 6: 91,477,354 M41K probably benign Het
Tmprss6 A C 15: 78,440,303 W771G probably damaging Het
Trp53tg5 T C 2: 164,471,336 T140A probably benign Het
Uchl1 A G 5: 66,686,873 E206G probably damaging Het
Vash2 A G 1: 190,960,291 V229A possibly damaging Het
Vmn1r192 C A 13: 22,187,214 A279S possibly damaging Het
Vmn1r32 T C 6: 66,553,172 R207G probably damaging Het
Vmn2r14 T A 5: 109,220,395 M244L probably benign Het
Vwa5b2 T A 16: 20,595,339 H236Q probably damaging Het
Zfp652 C T 11: 95,749,290 P14S probably benign Het
Zfp668 G A 7: 127,867,823 R194* probably null Het
Zgrf1 G T 3: 127,561,025 V98L probably benign Het
Other mutations in Inf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Inf2 APN 12 112611856 nonsense probably null
IGL01582:Inf2 APN 12 112610559 missense unknown
IGL02078:Inf2 APN 12 112601614 missense probably damaging 1.00
IGL02534:Inf2 APN 12 112610496 missense unknown
IGL03122:Inf2 APN 12 112604229 missense probably benign 0.03
IGL03296:Inf2 APN 12 112604208 nonsense probably null
Talon UTSW 12 112610287 splice site probably benign
R0413:Inf2 UTSW 12 112601676 missense probably damaging 1.00
R0552:Inf2 UTSW 12 112612574 intron probably benign
R0920:Inf2 UTSW 12 112610287 splice site probably benign
R1240:Inf2 UTSW 12 112610776 missense unknown
R1452:Inf2 UTSW 12 112601344 missense probably damaging 0.99
R1974:Inf2 UTSW 12 112608337 missense unknown
R2422:Inf2 UTSW 12 112610824 missense unknown
R3877:Inf2 UTSW 12 112610830 missense unknown
R4108:Inf2 UTSW 12 112607581 missense unknown
R4490:Inf2 UTSW 12 112600204 missense probably damaging 1.00
R5071:Inf2 UTSW 12 112612039 splice site probably null
R5074:Inf2 UTSW 12 112612039 splice site probably null
R5306:Inf2 UTSW 12 112601553 missense probably benign 0.26
R5383:Inf2 UTSW 12 112600145 missense probably damaging 0.99
R5664:Inf2 UTSW 12 112611728 missense unknown
R6157:Inf2 UTSW 12 112604788 unclassified probably benign
R6221:Inf2 UTSW 12 112603745 missense possibly damaging 0.66
R6429:Inf2 UTSW 12 112604256 missense probably benign 0.01
R6955:Inf2 UTSW 12 112610731 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAGACTCTCCTGCCAGAGC -3'
(R):5'- TCTATCTACCACAGGAGCCG -3'

Sequencing Primer
(F):5'- TGCCAGAGCACACCCTG -3'
(R):5'- TGGTAGGAAGCACCCAGACC -3'
Posted On2016-10-24