Incidental Mutation 'R5578:Wdr63'
ID437292
Institutional Source Beutler Lab
Gene Symbol Wdr63
Ensembl Gene ENSMUSG00000043020
Gene NameWD repeat domain 63
Synonyms4931433A13Rik
MMRRC Submission 043133-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5578 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location146040526-146108130 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 146097228 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 69 (Y69*)
Ref Sequence ENSEMBL: ENSMUSP00000124475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160285]
Predicted Effect probably null
Transcript: ENSMUST00000160285
AA Change: Y69*
SMART Domains Protein: ENSMUSP00000124475
Gene: ENSMUSG00000043020
AA Change: Y69*

DomainStartEndE-ValueType
low complexity region 3 22 N/A INTRINSIC
low complexity region 26 35 N/A INTRINSIC
low complexity region 133 150 N/A INTRINSIC
low complexity region 165 180 N/A INTRINSIC
Blast:WD40 321 367 6e-19 BLAST
low complexity region 375 383 N/A INTRINSIC
WD40 390 429 6.34e-2 SMART
WD40 470 527 1.15e-4 SMART
low complexity region 536 553 N/A INTRINSIC
WD40 693 732 1.07e1 SMART
WD40 737 776 1.1e2 SMART
coiled coil region 867 902 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap2 A G 16: 31,108,114 S521P probably benign Het
Aqp11 A G 7: 97,737,458 F177S probably damaging Het
Arhgap40 G T 2: 158,531,206 G128V probably damaging Het
Aspm A T 1: 139,470,717 K1011I probably damaging Het
Cachd1 A G 4: 100,865,006 T89A probably benign Het
Cep89 ACTCCTCCTCCTCCTCCTCCTCCTC ACTCCTCCTCCTCCTCCTCCTC 7: 35,409,642 probably benign Het
Cfhr2 A T 1: 139,831,068 C81* probably null Het
Chd7 A G 4: 8,847,149 T1631A probably benign Het
Clca4b T A 3: 144,932,435 D22V probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp39a1 T A 17: 43,680,140 N113K possibly damaging Het
Dnah11 A T 12: 118,018,802 V2544D probably damaging Het
Esr1 A C 10: 4,969,164 Q418P probably damaging Het
Fam89a T A 8: 124,741,229 K115* probably null Het
Fstl4 T A 11: 53,165,781 V455D probably damaging Het
Gm10031 A G 1: 156,525,230 M334V probably benign Het
Gm20730 T A 6: 43,081,540 M113L probably benign Het
Hist2h2ab T C 3: 96,220,238 V108A probably damaging Het
Hk3 C T 13: 55,012,181 V327M probably damaging Het
Itm2c T A 1: 85,903,053 V57E possibly damaging Het
Lrba T C 3: 86,757,507 Y565H probably benign Het
Mab21l1 C T 3: 55,784,014 Q341* probably null Het
Mdm2 C T 10: 117,702,287 E69K possibly damaging Het
Mdn1 A T 4: 32,728,167 I2709F probably benign Het
Mpp7 T C 18: 7,355,101 N442D probably benign Het
Ncoa3 A G 2: 166,054,328 I384V probably benign Het
Pm20d1 A G 1: 131,816,022 N475S probably benign Het
Rhpn2 A G 7: 35,370,710 D131G probably damaging Het
S1pr5 T A 9: 21,244,551 Y193F probably damaging Het
Sdk1 A T 5: 141,613,125 K182* probably null Het
Slx4 T A 16: 3,986,862 E696V probably damaging Het
Smyd4 C T 11: 75,404,776 P753S probably benign Het
Stambp T G 6: 83,561,800 D206A probably benign Het
Sult5a1 G T 8: 123,143,121 Y262* probably null Het
Taar1 A T 10: 23,920,820 I139F possibly damaging Het
Tchh A T 3: 93,444,311 R353* probably null Het
Thnsl2 C T 6: 71,138,765 V153I probably benign Het
Trmt5 C T 12: 73,285,063 probably null Het
Trpa1 T A 1: 14,887,008 Y728F probably damaging Het
Usp19 T C 9: 108,493,440 V126A probably benign Het
Vcan A G 13: 89,691,503 V1974A probably benign Het
Vmn2r120 T A 17: 57,522,514 H461L probably benign Het
Zfp445 T C 9: 122,853,337 Y513C probably benign Het
Zfp84 A C 7: 29,775,431 M43L possibly damaging Het
Other mutations in Wdr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Wdr63 APN 3 146083004 missense probably benign
IGL00565:Wdr63 APN 3 146044919 splice site probably benign
IGL01339:Wdr63 APN 3 146042836 missense probably benign 0.14
IGL01952:Wdr63 APN 3 146097163 missense probably damaging 0.96
IGL02663:Wdr63 APN 3 146054557 missense possibly damaging 0.53
IGL02710:Wdr63 APN 3 146048148 missense possibly damaging 0.96
P0041:Wdr63 UTSW 3 146081242 missense possibly damaging 0.96
R0014:Wdr63 UTSW 3 146081423 splice site probably null
R0014:Wdr63 UTSW 3 146081423 splice site probably null
R0498:Wdr63 UTSW 3 146081364 missense possibly damaging 0.54
R0589:Wdr63 UTSW 3 146062331 missense probably benign 0.01
R1484:Wdr63 UTSW 3 146097241 missense probably benign 0.02
R1537:Wdr63 UTSW 3 146042749 missense probably damaging 0.98
R1611:Wdr63 UTSW 3 146095358 missense probably damaging 1.00
R1743:Wdr63 UTSW 3 146097262 missense possibly damaging 0.81
R1861:Wdr63 UTSW 3 146083046 missense probably damaging 1.00
R1991:Wdr63 UTSW 3 146063480 missense possibly damaging 0.82
R2185:Wdr63 UTSW 3 146066864 missense possibly damaging 0.76
R4299:Wdr63 UTSW 3 146068806 missense probably damaging 1.00
R4620:Wdr63 UTSW 3 146042809 missense probably damaging 1.00
R4649:Wdr63 UTSW 3 146048167 missense probably damaging 1.00
R4914:Wdr63 UTSW 3 146066827 missense probably damaging 0.98
R4948:Wdr63 UTSW 3 146083065 nonsense probably null
R6130:Wdr63 UTSW 3 146042804 missense probably benign 0.25
R6162:Wdr63 UTSW 3 146044862 missense probably damaging 1.00
R6291:Wdr63 UTSW 3 146066893 missense probably benign 0.00
R6390:Wdr63 UTSW 3 146095388 missense probably damaging 1.00
R6560:Wdr63 UTSW 3 146095406 missense possibly damaging 0.79
R6893:Wdr63 UTSW 3 146080429 missense probably damaging 1.00
R7090:Wdr63 UTSW 3 146040827 missense possibly damaging 0.80
R7102:Wdr63 UTSW 3 146055704 missense possibly damaging 0.49
R7111:Wdr63 UTSW 3 146097273 missense probably damaging 0.99
R7260:Wdr63 UTSW 3 146046540 missense probably benign 0.01
R7288:Wdr63 UTSW 3 146081252 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCGTTGATGCAAAATCTTCCTAAC -3'
(R):5'- CCAAGTGCTGGGATTAGAGG -3'

Sequencing Primer
(F):5'- GCAAAATCTTCCTAACTTGTGTTGTG -3'
(R):5'- ATTAGAGGTGTGCGCCAC -3'
Posted On2016-10-26